EMAIL THIS PAGE TO A FRIEND

TRMT61B

tRNA methyltransferase 61 homolog B (S. cerevisiae)

UniProtKB ID: Q9BVS5, Q9H0Q9, Q9NWS7
Gene ID:
Mouse(68789) tRNA methyltransferase 61B
naked mole-rat(101700118) tRNA methyltransferase 61 homolog B (S. cerevisiae)
domestic guinea pig(100731210) tRNA methyltransferase 61 homolog B (S. cerevisiae)
cow(535837) tRNA methyltransferase 61 homolog B (S. cerevisiae)
sheep(101102217) tRNA methyltransferase 61 homolog B (S. cerevisiae)
chicken(101748994) tRNA methyltransferase 61 homolog B (S. cerevisiae)
domestic cat(101092430) tRNA methyltransferase 61 homolog B (S. cerevisiae)
dog(483017) tRNA methyltransferase 61 homolog B (S. cerevisiae)
chicken(101668958) tRNA methyltransferase 61 homolog B (S. cerevisiae)
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017910 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017910 Rosetta Predictions human pricing
XR_005147 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233806 predicted 1541
2 SASI_Hs01_00233807 predicted 665
3 SASI_Hs01_00233808 predicted 541
4 SASI_Hs01_00233809 predicted 963
5 SASI_Hs01_00233811 predicted 747
6 SASI_Hs01_00233812 predicted 1432
7 SASI_Hs02_00350886 predicted 538
8 SASI_Hs01_00233813 predicted 1037
9 SASI_Hs01_00233814 predicted 1314
10 SASI_Hs01_00233815 predicted 1254
11 SASI_Hs01_00233810 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00453582 predicted 902
2 SASI_Mm02_00453583 predicted 840
3 SASI_Mm02_00453584 predicted 514
4 SASI_Mm02_00453585 predicted 430
5 SASI_Mm02_00453586 predicted 506
6 SASI_Mm02_00453587 predicted 750
7 SASI_Mm02_00453588 predicted 425
8 SASI_Mm02_00453589 predicted 418
9 SASI_Mm02_00453590 predicted 437
10 SASI_Mm02_00453591 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017910
VALIDATED
TRMT61B MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 61 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017910.2-616s1c1
Sequence:CCGGCCAGATACTGAGGAGTTCCTTCTCGAGAAGGAACTCCTCAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017910.2-1179s1c1
Sequence:CCGGGCGAGGTCATTGTCAGAGATTCTCGAGAATCTCTGACAATGACCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017910.2-789s1c1
Sequence:CCGGGCTCTGGTGGAATGAGCTTATCTCGAGATAAGCTCATTCCACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017910.2-1146s1c1
Sequence:CCGGCCTGTGAACTTGCTCTTTCATCTCGAGATGAAAGAGCAAGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017910.2-1653s1c1
Sequence:CCGGGTCTTGCAGTTAGTTTGACATCTCGAGATGTCAAACTAACTGCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017910.2-1465s1c1
Sequence:CCGGGATGACAGTAACTGACTTGAACTCGAGTTCAAGTCAGTTACTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-695s21c1
Sequence:CCGGAGAGGGACTGCCATAACATTCCTCGAGGAATGTTATGGCAGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-543s21c1
Sequence:GTACCGGTGAACAACTTCGGACTCTTAACTCGAGTTAAGAGTCCGAAGTTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-1103s21c1
Sequence:CCGGGTAAACATCACACAGGTTATTCTCGAGAATAACCTGTGTGATGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-791s21c1
Sequence:CCGGTCTGGTGGAATGAGCTTATTTCTCGAGAAATAAGCTCATTCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-828s21c1
Sequence:CCGGGATCACAAGGACGAGTCATAACTCGAGTTATGACTCGTCCTTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017910
VALIDATED
TRMT61B MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 61 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017910.2-616s1c1
Sequence:CCGGCCAGATACTGAGGAGTTCCTTCTCGAGAAGGAACTCCTCAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017910.2-1179s1c1
Sequence:CCGGGCGAGGTCATTGTCAGAGATTCTCGAGAATCTCTGACAATGACCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017910.2-789s1c1
Sequence:CCGGGCTCTGGTGGAATGAGCTTATCTCGAGATAAGCTCATTCCACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017910.2-1146s1c1
Sequence:CCGGCCTGTGAACTTGCTCTTTCATCTCGAGATGAAAGAGCAAGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017910.2-1653s1c1
Sequence:CCGGGTCTTGCAGTTAGTTTGACATCTCGAGATGTCAAACTAACTGCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017910.2-1465s1c1
Sequence:CCGGGATGACAGTAACTGACTTGAACTCGAGTTCAAGTCAGTTACTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-695s21c1
Sequence:CCGGAGAGGGACTGCCATAACATTCCTCGAGGAATGTTATGGCAGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-543s21c1
Sequence:GTACCGGTGAACAACTTCGGACTCTTAACTCGAGTTAAGAGTCCGAAGTTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-1103s21c1
Sequence:CCGGGTAAACATCACACAGGTTATTCTCGAGAATAACCTGTGTGATGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-791s21c1
Sequence:CCGGTCTGGTGGAATGAGCTTATTTCTCGAGAAATAAGCTCATTCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-828s21c1
Sequence:CCGGGATCACAAGGACGAGTCATAACTCGAGTTATGACTCGTCCTTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017910
VALIDATED
TRMT61B MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 61 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017910.2-616s1c1
Sequence:CCGGCCAGATACTGAGGAGTTCCTTCTCGAGAAGGAACTCCTCAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017910.2-1179s1c1
Sequence:CCGGGCGAGGTCATTGTCAGAGATTCTCGAGAATCTCTGACAATGACCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017910.2-789s1c1
Sequence:CCGGGCTCTGGTGGAATGAGCTTATCTCGAGATAAGCTCATTCCACCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017910.2-1146s1c1
Sequence:CCGGCCTGTGAACTTGCTCTTTCATCTCGAGATGAAAGAGCAAGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017910.2-1653s1c1
Sequence:CCGGGTCTTGCAGTTAGTTTGACATCTCGAGATGTCAAACTAACTGCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017910.2-1465s1c1
Sequence:CCGGGATGACAGTAACTGACTTGAACTCGAGTTCAAGTCAGTTACTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-695s21c1
Sequence:CCGGAGAGGGACTGCCATAACATTCCTCGAGGAATGTTATGGCAGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-543s21c1
Sequence:GTACCGGTGAACAACTTCGGACTCTTAACTCGAGTTAAGAGTCCGAAGTTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-1103s21c1
Sequence:CCGGGTAAACATCACACAGGTTATTCTCGAGAATAACCTGTGTGATGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-791s21c1
Sequence:CCGGTCTGGTGGAATGAGCTTATTTCTCGAGAAATAAGCTCATTCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017910.2-828s21c1
Sequence:CCGGGATCACAAGGACGAGTCATAACTCGAGTTATGACTCGTCCTTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks