EMAIL THIS PAGE TO A FRIEND

TRMT6

tRNA methyltransferase 6 homolog (S. cerevisiae)

Synonyms: GCD10 Gcd10p
UniProtKB ID: Q9UJA5, Q76P92, Q9BQV5, Q9ULR7, Q9Y2Z8
Gene ID:
Human(51605) Summary: The protein encoded by this gene is similar to an uncharacterized protein from C. elegans. Although the function of the encoded protein is unknown, it shares weak sequence similarity to a region of S. cerevisiae translation initiation factor subunit Gcd10p. [provided by RefSeq, Jul 2008]
Mouse(66926) tRNA methyltransferase 6
Rat(311441) tRNA methyltransferase 6 homolog (S. cerevisiae)
naked mole-rat(101718624) tRNA methyltransferase 6 homolog (S. cerevisiae)
Domestic Rabbit(100340902) tRNA methyltransferase 6 homolog (S. cerevisiae)
domestic guinea pig(100735579) tRNA methyltransferase 6 homolog (S. cerevisiae)
cow(505816) tRNA methyltransferase 6 homolog (S. cerevisiae)
sheep(101116247) tRNA methyltransferase 6 homolog (S. cerevisiae)
Zebrafish(563475) tRNA methyltransferase 6 homolog (S. cerevisiae)
chicken(421313) tRNA methyltransferase 6 homolog (S. cerevisiae)
domestic cat(101081719) tRNA methyltransferase 6 homolog (S. cerevisiae)
Horse(100051822) tRNA methyltransferase 6 homolog (S. cerevisiae)
dog(485777) tRNA methyltransferase 6 homolog (S. cerevisiae)
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015939 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015939 Rosetta Predictions human pricing
NM_001107779 Rosetta Predictions rat pricing
NM_175113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151729 predicted 1306
2 SASI_Hs01_00151730 predicted 1214
3 SASI_Hs01_00151731 predicted 1397
4 SASI_Hs02_00348574 predicted 1642
5 SASI_Hs01_00151733 predicted 1470
6 SASI_Hs01_00151734 predicted 937
7 SASI_Hs02_00348575 predicted 1647
8 SASI_Hs02_00348576 predicted 1656
9 SASI_Hs01_00151736 predicted 291
10 SASI_Hs02_00348577 predicted 1649
11 SASI_Hs01_00151732 predicted 1528
12 SASI_Hs01_00151735 predicted 904
13 SASI_Hs01_00151737 predicted 1010
14 SASI_Hs01_00151738 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232185 predicted 477
2 SASI_Rn02_00232186 predicted 1595
3 SASI_Rn02_00232187 predicted 608
4 SASI_Rn02_00232188 predicted 472
5 SASI_Rn02_00232189 predicted 698
6 SASI_Rn02_00232190 predicted 1365
7 SASI_Rn02_00232191 predicted 1388
8 SASI_Rn02_00232192 predicted 432
9 SASI_Rn02_00232193 predicted 379
10 SASI_Rn02_00232194 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345721 predicted 608
2 SASI_Mm02_00345722 predicted 472
3 SASI_Mm01_00155856 predicted 1613
4 SASI_Mm01_00155857 predicted 1594
5 SASI_Mm01_00155860 predicted 1031
6 SASI_Mm01_00155861 predicted 1098
7 SASI_Mm01_00155862 predicted 1314
8 SASI_Mm01_00155863 predicted 701
9 SASI_Mm01_00155865 predicted 857
10 SASI_Mm02_00345723 predicted 1391
11 SASI_Mm01_00155858 predicted 1737
12 SASI_Mm01_00155859 predicted 1224
13 SASI_Mm01_00155864 predicted 1134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015939
VALIDATED
TRMT6 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 6 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015939.3-941s1c1
Sequence:CCGGGATGTTATCTTCAGAGCCAAACTCGAGTTTGGCTCTGAAGATAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015939.3-665s1c1
Sequence:CCGGCCACATGAGATACGATACACTCTCGAGAGTGTATCGTATCTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015939.3-203s1c1
Sequence:CCGGGCTGAAACGTGAAGATGTGTTCTCGAGAACACATCTTCACGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015939.3-677s1c1
Sequence:CCGGCGATACACTAGCCCAGATGTTCTCGAGAACATCTGGGCTAGTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015939.3-1397s1c1
Sequence:CCGGGTCTGAAACCTGGCTCAGAAACTCGAGTTTCTGAGCCAGGTTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015939.3-1546s1c1
Sequence:CCGGGCACTTTAGAATCACACGAGACTCGAGTCTCGTGTGATTCTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015939.3-1119s1c1
Sequence:CCGGCCTAAAGAGAGAGGAAGCAAACTCGAGTTTGCTTCCTCTCTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015939.3-1649s21c1
Sequence:CCGGAGGCATTATACAGTTAGTAATCTCGAGATTACTAACTGTATAATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015939.3-2091s21c1
Sequence:CCGGTTCTTTCCTGCAGCGGAATAACTCGAGTTATTCCGCTGCAGGAAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015939.3-1222s21c1
Sequence:CCGGGAAACGCAGATGGTTTAATTGCTCGAGCAATTAAACCATCTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015939
VALIDATED
TRMT6 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 6 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015939.3-941s1c1
Sequence:CCGGGATGTTATCTTCAGAGCCAAACTCGAGTTTGGCTCTGAAGATAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015939.3-665s1c1
Sequence:CCGGCCACATGAGATACGATACACTCTCGAGAGTGTATCGTATCTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015939.3-203s1c1
Sequence:CCGGGCTGAAACGTGAAGATGTGTTCTCGAGAACACATCTTCACGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015939.3-677s1c1
Sequence:CCGGCGATACACTAGCCCAGATGTTCTCGAGAACATCTGGGCTAGTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015939.3-1397s1c1
Sequence:CCGGGTCTGAAACCTGGCTCAGAAACTCGAGTTTCTGAGCCAGGTTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015939.3-1546s1c1
Sequence:CCGGGCACTTTAGAATCACACGAGACTCGAGTCTCGTGTGATTCTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015939.3-1119s1c1
Sequence:CCGGCCTAAAGAGAGAGGAAGCAAACTCGAGTTTGCTTCCTCTCTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015939.3-1649s21c1
Sequence:CCGGAGGCATTATACAGTTAGTAATCTCGAGATTACTAACTGTATAATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015939.3-2091s21c1
Sequence:CCGGTTCTTTCCTGCAGCGGAATAACTCGAGTTATTCCGCTGCAGGAAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015939.3-1222s21c1
Sequence:CCGGGAAACGCAGATGGTTTAATTGCTCGAGCAATTAAACCATCTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015939
VALIDATED
TRMT6 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 6 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015939.3-941s1c1
Sequence:CCGGGATGTTATCTTCAGAGCCAAACTCGAGTTTGGCTCTGAAGATAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015939.3-665s1c1
Sequence:CCGGCCACATGAGATACGATACACTCTCGAGAGTGTATCGTATCTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015939.3-203s1c1
Sequence:CCGGGCTGAAACGTGAAGATGTGTTCTCGAGAACACATCTTCACGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015939.3-677s1c1
Sequence:CCGGCGATACACTAGCCCAGATGTTCTCGAGAACATCTGGGCTAGTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015939.3-1397s1c1
Sequence:CCGGGTCTGAAACCTGGCTCAGAAACTCGAGTTTCTGAGCCAGGTTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015939.3-1546s1c1
Sequence:CCGGGCACTTTAGAATCACACGAGACTCGAGTCTCGTGTGATTCTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015939.3-1119s1c1
Sequence:CCGGCCTAAAGAGAGAGGAAGCAAACTCGAGTTTGCTTCCTCTCTCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015939.3-1649s21c1
Sequence:CCGGAGGCATTATACAGTTAGTAATCTCGAGATTACTAACTGTATAATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015939.3-2091s21c1
Sequence:CCGGTTCTTTCCTGCAGCGGAATAACTCGAGTTATTCCGCTGCAGGAAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015939.3-1222s21c1
Sequence:CCGGGAAACGCAGATGGTTTAATTGCTCGAGCAATTAAACCATCTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175113
VALIDATED
TRMT6 MISSION shRNA Bacterial Glycerol Stock
tRNA methyltransferase 6 homolog (S. cerevisiae)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175113.1-1218s1c1
Sequence:CCGGCCAGAGAATAAGGAGCCCAAACTCGAGTTTGGGCTCCTTATTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175113.1-1125s1c1
Sequence:CCGGGAGATTGCTGAACAAGCGGATCTCGAGATCCGCTTGTTCAGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175113.1-1019s1c1
Sequence:CCGGCAAAGTAAACAGTCTCCTCAACTCGAGTTGAGGAGACTGTTTACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175113.1-1453s1c1
Sequence:CCGGCTTTGTTGGAATGCTACACAACTCGAGTTGTGTAGCATTCCAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175113.1-1005s1c1
Sequence:CCGGGAGTTCCCTCTCAACAAAGTACTCGAGTACTTTGTTGAGAGGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175113.1-1084s1c1
Sequence:CCGGGCACTCCAGTTGAAGAAAGTACTCGAGTACTTTCTTCAACTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175113.1-989s1c1
Sequence:CCGGCCTCAGTGGTCTTTACGAGTTCTCGAGAACTCGTAAAGACCACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175113.1-2422s1c1
Sequence:CCGGGCATACACATAGATGTATCTACTCGAGTAGATACATCTATGTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200119    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175113.1-2224s1c1
Sequence:CCGGCCTGAGGAAGATCCAGGTATTCTCGAGAATACCTGGATCTTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-604s21c1
Sequence:CCGGTTGAAGCCATCTACCCGTATTCTCGAGAATACGGGTAGATGGCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-889s21c1
Sequence:CCGGGAGTTCCCTCTCAACAAAGTACTCGAGTACTTTGTTGAGAGGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-1433s21c1
Sequence:CCGGATCGGAGTCATCCCAAATTATCTCGAGATAATTTGGGATGACTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-393s21c1
Sequence:CCGGAGGCACTGATAATCGAAATATCTCGAGATATTTCGATTATCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-1643s21c1
Sequence:CCGGGCATTCTGCAGCTGGTAATTACTCGAGTAATTACCAGCTGCAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175113
VALIDATED
TRMT6 MISSION shRNA shRNA Plasmid DNA
tRNA methyltransferase 6 homolog (S. cerevisiae)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175113.1-1218s1c1
Sequence:CCGGCCAGAGAATAAGGAGCCCAAACTCGAGTTTGGGCTCCTTATTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175113.1-1125s1c1
Sequence:CCGGGAGATTGCTGAACAAGCGGATCTCGAGATCCGCTTGTTCAGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175113.1-1019s1c1
Sequence:CCGGCAAAGTAAACAGTCTCCTCAACTCGAGTTGAGGAGACTGTTTACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175113.1-1453s1c1
Sequence:CCGGCTTTGTTGGAATGCTACACAACTCGAGTTGTGTAGCATTCCAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175113.1-1005s1c1
Sequence:CCGGGAGTTCCCTCTCAACAAAGTACTCGAGTACTTTGTTGAGAGGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175113.1-1084s1c1
Sequence:CCGGGCACTCCAGTTGAAGAAAGTACTCGAGTACTTTCTTCAACTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175113.1-989s1c1
Sequence:CCGGCCTCAGTGGTCTTTACGAGTTCTCGAGAACTCGTAAAGACCACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175113.1-2422s1c1
Sequence:CCGGGCATACACATAGATGTATCTACTCGAGTAGATACATCTATGTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200119    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175113.1-2224s1c1
Sequence:CCGGCCTGAGGAAGATCCAGGTATTCTCGAGAATACCTGGATCTTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-604s21c1
Sequence:CCGGTTGAAGCCATCTACCCGTATTCTCGAGAATACGGGTAGATGGCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-889s21c1
Sequence:CCGGGAGTTCCCTCTCAACAAAGTACTCGAGTACTTTGTTGAGAGGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-1433s21c1
Sequence:CCGGATCGGAGTCATCCCAAATTATCTCGAGATAATTTGGGATGACTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-393s21c1
Sequence:CCGGAGGCACTGATAATCGAAATATCTCGAGATATTTCGATTATCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-1643s21c1
Sequence:CCGGGCATTCTGCAGCTGGTAATTACTCGAGTAATTACCAGCTGCAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175113
VALIDATED
TRMT6 MISSION shRNA Lentiviral Transduction Particles
tRNA methyltransferase 6 homolog (S. cerevisiae)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175113.1-1218s1c1
Sequence:CCGGCCAGAGAATAAGGAGCCCAAACTCGAGTTTGGGCTCCTTATTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175113.1-1125s1c1
Sequence:CCGGGAGATTGCTGAACAAGCGGATCTCGAGATCCGCTTGTTCAGCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175113.1-1019s1c1
Sequence:CCGGCAAAGTAAACAGTCTCCTCAACTCGAGTTGAGGAGACTGTTTACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175113.1-1453s1c1
Sequence:CCGGCTTTGTTGGAATGCTACACAACTCGAGTTGTGTAGCATTCCAACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175113.1-1005s1c1
Sequence:CCGGGAGTTCCCTCTCAACAAAGTACTCGAGTACTTTGTTGAGAGGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175113.1-1084s1c1
Sequence:CCGGGCACTCCAGTTGAAGAAAGTACTCGAGTACTTTCTTCAACTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175113.1-989s1c1
Sequence:CCGGCCTCAGTGGTCTTTACGAGTTCTCGAGAACTCGTAAAGACCACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175113.1-2422s1c1
Sequence:CCGGGCATACACATAGATGTATCTACTCGAGTAGATACATCTATGTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200119    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175113.1-2224s1c1
Sequence:CCGGCCTGAGGAAGATCCAGGTATTCTCGAGAATACCTGGATCTTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-604s21c1
Sequence:CCGGTTGAAGCCATCTACCCGTATTCTCGAGAATACGGGTAGATGGCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-889s21c1
Sequence:CCGGGAGTTCCCTCTCAACAAAGTACTCGAGTACTTTGTTGAGAGGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-1433s21c1
Sequence:CCGGATCGGAGTCATCCCAAATTATCTCGAGATAATTTGGGATGACTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-393s21c1
Sequence:CCGGAGGCACTGATAATCGAAATATCTCGAGATATTTCGATTATCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175113.3-1643s21c1
Sequence:CCGGGCATTCTGCAGCTGGTAATTACTCGAGTAATTACCAGCTGCAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks