EMAIL THIS PAGE TO A FRIEND

TRMU

tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase

Synonyms: MTO2 MTU1 TRMT TRMT1 TRNT1
Gene ID:
Human(55687) Summary: This gene is a member of the trmU family. It encodes a mitochondria-specific tRNA-modifying enzyme that is required for the 2-thio modification of 5-taurinomethyl-2-thiouridine tRNA-Lys on the wobble position of the anticodon. [provided by RefSeq, Jul 2008]
Mouse(72026) tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Rat(362976) tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Zebrafish(553625) tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
chicken(425909) tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
domestic cat(101097570) tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
dog(481204) tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
cow(616451) tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
sheep(101110834) tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
domestic guinea pig(100724979) tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
naked mole-rat(101722647) tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028063 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028063 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028063 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018006 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008568 Rosetta Predictions human pricing
NM_001008569 Rosetta Predictions human pricing
NM_001008570 Rosetta Predictions human pricing
NM_001008571 Rosetta Predictions human pricing
NM_018006 Rosetta Predictions human pricing
XM_001078327 Rosetta Predictions rat pricing
XM_343306 Rosetta Predictions rat pricing
NM_028063 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210813 predicted 1158
2 SASI_Hs01_00210814 predicted 1329
3 SASI_Hs01_00210815 predicted 1073
4 SASI_Hs01_00210816 predicted 1049
5 SASI_Hs01_00210817 predicted 1080
6 SASI_Hs01_00210818 predicted 1049
7 SASI_Hs01_00210819 predicted 1286
8 SASI_Hs01_00210820 predicted 536
9 SASI_Hs01_00210821 predicted 667
10 SASI_Hs01_00210822 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117268 predicted 1112
2 SASI_Hs01_00117269 predicted 1028
3 SASI_Hs01_00117270 predicted 998
4 SASI_Hs01_00117271 predicted 1029
5 SASI_Hs01_00117272 predicted 997
6 SASI_Hs01_00117273 predicted 543
7 SASI_Hs01_00117274 predicted 520
8 SASI_Hs01_00117275 predicted 572
9 SASI_Hs01_00117276 predicted 643
10 SASI_Hs01_00117277 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200807 predicted 1053
2 SASI_Hs01_00200808 predicted 963
3 SASI_Hs01_00200809 predicted 952
4 SASI_Hs01_00200810 predicted 972
5 SASI_Hs01_00200811 predicted 938
6 SASI_Hs01_00200812 predicted 854
7 SASI_Hs01_00200813 predicted 512
8 SASI_Hs01_00200814 predicted 859
9 SASI_Hs01_00200815 predicted 1050
10 SASI_Hs01_00200816 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143495 predicted 1046
2 SASI_Hs01_00143496 predicted 962
3 SASI_Hs01_00143497 predicted 948
4 SASI_Hs01_00143498 predicted 970
5 SASI_Hs01_00143499 predicted 849
6 SASI_Hs01_00143500 predicted 519
7 SASI_Hs01_00143501 predicted 854
8 SASI_Hs01_00143502 predicted 1045
9 SASI_Hs01_00143503 predicted 573
10 SASI_Hs01_00143504 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351081 predicted 528
2 SASI_Hs02_00351082 predicted 512
3 SASI_Hs01_00230303 predicted 1128
4 SASI_Hs02_00351083 predicted 664
5 SASI_Hs02_00351084 predicted 673
6 SASI_Hs02_00351085 predicted 750
7 SASI_Hs02_00351086 predicted 564
8 SASI_Hs01_00230305 predicted 1107
9 SASI_Hs01_00230306 predicted 1134
10 SASI_Hs02_00351087 predicted 588
11 SASI_Hs01_00230301 predicted 1214
12 SASI_Hs01_00230302 predicted 1390
13 SASI_Hs01_00230304 predicted 1628
14 SASI_Hs01_00230307 predicted 1454
15 SASI_Hs01_00230308 predicted 1533
16 SASI_Hs01_00230309 predicted 1099
17 SASI_Hs01_00230310 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360398 predicted 861
2 SASI_Rn02_00360399 predicted 400
3 SASI_Rn02_00360400 predicted 232
4 SASI_Rn02_00360401 predicted 1161
5 SASI_Rn02_00360402 predicted 512
6 SASI_Rn02_00360403 predicted 309
7 SASI_Rn02_00360404 predicted 524
8 SASI_Rn02_00360405 predicted 293
9 SASI_Rn02_00360406 predicted 748
10 SASI_Rn02_00360407 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395633 predicted 992
2 SASI_Rn02_00395634 predicted 1156
3 SASI_Rn02_00395635 predicted 508
4 SASI_Rn02_00395636 predicted 1216
5 SASI_Rn02_00395637 predicted 1336
6 SASI_Rn02_00395638 predicted 516
7 SASI_Rn02_00395639 predicted 1119
8 SASI_Rn02_00395640 predicted 240
9 SASI_Rn02_00395641 predicted 283
10 SASI_Rn02_00395642 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054966 predicted 846
2 SASI_Mm01_00054967 predicted 216
3 SASI_Mm01_00054968 predicted 1138
4 SASI_Mm01_00054969 predicted 778
5 SASI_Mm01_00054970 predicted 822
6 SASI_Mm01_00054971 predicted 1148
7 SASI_Mm01_00054972 predicted 359
8 SASI_Mm01_00054973 predicted 810
9 SASI_Mm01_00054974 predicted 477
10 SASI_Mm02_00333265 predicted 208
11 SASI_Mm01_00054975 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028063
VALIDATED
TRMU MISSION shRNA Bacterial Glycerol Stock
tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-495s21c1
Sequence:CCGGGGGCTGTTCAGAAATCGATTTCTCGAGAAATCGATTTCTGAACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-780s21c1
Sequence:CCGGTTTGTTTCTATCGAGGATAATCTCGAGATTATCCTCGATAGAAACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-1335s21c1
Sequence:CCGGGTCGTCAGTGATGGGTGTTAGCTCGAGCTAACACCCATCACTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-207s21c1
Sequence:CCGGGACTGTGAAGATGCGTATAAACTCGAGTTTATACGCATCTTCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028063.2-207s1c1
Sequence:CCGGGACTGTGAAGATGCGTATAAACTCGAGTTTATACGCATCTTCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-339s21c1
Sequence:CCGGCCCGACATCAACTGCAATAAGCTCGAGCTTATTGCAGTTGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028063.1-270s1c1
Sequence:CCGGGTGAAGGAGTATTGGAATGATCTCGAGATCATTCCAATACTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028063.1-779s1c1
Sequence:CCGGGTTTGTTTCTATCGAGGATAACTCGAGTTATCCTCGATAGAAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028063
VALIDATED
TRMU MISSION shRNA shRNA Plasmid DNA
tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-495s21c1
Sequence:CCGGGGGCTGTTCAGAAATCGATTTCTCGAGAAATCGATTTCTGAACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-780s21c1
Sequence:CCGGTTTGTTTCTATCGAGGATAATCTCGAGATTATCCTCGATAGAAACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-1335s21c1
Sequence:CCGGGTCGTCAGTGATGGGTGTTAGCTCGAGCTAACACCCATCACTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-207s21c1
Sequence:CCGGGACTGTGAAGATGCGTATAAACTCGAGTTTATACGCATCTTCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028063.2-207s1c1
Sequence:CCGGGACTGTGAAGATGCGTATAAACTCGAGTTTATACGCATCTTCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-339s21c1
Sequence:CCGGCCCGACATCAACTGCAATAAGCTCGAGCTTATTGCAGTTGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028063.1-270s1c1
Sequence:CCGGGTGAAGGAGTATTGGAATGATCTCGAGATCATTCCAATACTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028063.1-779s1c1
Sequence:CCGGGTTTGTTTCTATCGAGGATAACTCGAGTTATCCTCGATAGAAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028063
VALIDATED
TRMU MISSION shRNA Lentiviral Transduction Particles
tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-495s21c1
Sequence:CCGGGGGCTGTTCAGAAATCGATTTCTCGAGAAATCGATTTCTGAACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-780s21c1
Sequence:CCGGTTTGTTTCTATCGAGGATAATCTCGAGATTATCCTCGATAGAAACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-1335s21c1
Sequence:CCGGGTCGTCAGTGATGGGTGTTAGCTCGAGCTAACACCCATCACTGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-207s21c1
Sequence:CCGGGACTGTGAAGATGCGTATAAACTCGAGTTTATACGCATCTTCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028063.2-207s1c1
Sequence:CCGGGACTGTGAAGATGCGTATAAACTCGAGTTTATACGCATCTTCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028063.2-339s21c1
Sequence:CCGGCCCGACATCAACTGCAATAAGCTCGAGCTTATTGCAGTTGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028063.1-270s1c1
Sequence:CCGGGTGAAGGAGTATTGGAATGATCTCGAGATCATTCCAATACTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028063.1-779s1c1
Sequence:CCGGGTTTGTTTCTATCGAGGATAACTCGAGTTATCCTCGATAGAAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018006
TRMU MISSION shRNA Bacterial Glycerol Stock
tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-577s21c1
Sequence:CCGGGTCCTACGTAAAGGAGTATTGCTCGAGCAATACTCCTTTACGTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-829s21c1
Sequence:CCGGTGAAGTTAGAAATGCGGTAAACTCGAGTTTACCGCATTTCTAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018006.4-1632s21c1
Sequence:CCGGAGAGATGGATCTGCTAGAAGGCTCGAGCCTTCTAGCAGATCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-1079s21c1
Sequence:CCGGCCTCGACCTGGTCACTTTATTCTCGAGAATAAAGTGACCAGGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-779s21c1
Sequence:CCGGTTTGAGCAGAAGCACGTTAAGCTCGAGCTTAACGTGCTTCTGCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018006.2-772s1c1
Sequence:CCGGCCTGGTCACTTTATTTCCATACTCGAGTATGGAAATAAAGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018006.2-425s1c1
Sequence:CCGGCAGGTCACTATGCAAGAACTTCTCGAGAAGTTCTTGCATAGTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018006.2-233s1c1
Sequence:CCGGGCCAGATCTTAGACATCCCTTCTCGAGAAGGGATGTCTAAGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018006
TRMU MISSION shRNA shRNA Plasmid DNA
tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-577s21c1
Sequence:CCGGGTCCTACGTAAAGGAGTATTGCTCGAGCAATACTCCTTTACGTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-829s21c1
Sequence:CCGGTGAAGTTAGAAATGCGGTAAACTCGAGTTTACCGCATTTCTAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018006.4-1632s21c1
Sequence:CCGGAGAGATGGATCTGCTAGAAGGCTCGAGCCTTCTAGCAGATCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-1079s21c1
Sequence:CCGGCCTCGACCTGGTCACTTTATTCTCGAGAATAAAGTGACCAGGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-779s21c1
Sequence:CCGGTTTGAGCAGAAGCACGTTAAGCTCGAGCTTAACGTGCTTCTGCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018006.2-772s1c1
Sequence:CCGGCCTGGTCACTTTATTTCCATACTCGAGTATGGAAATAAAGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018006.2-425s1c1
Sequence:CCGGCAGGTCACTATGCAAGAACTTCTCGAGAAGTTCTTGCATAGTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018006.2-233s1c1
Sequence:CCGGGCCAGATCTTAGACATCCCTTCTCGAGAAGGGATGTCTAAGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018006
TRMU MISSION shRNA Lentiviral Transduction Particles
tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-577s21c1
Sequence:CCGGGTCCTACGTAAAGGAGTATTGCTCGAGCAATACTCCTTTACGTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-829s21c1
Sequence:CCGGTGAAGTTAGAAATGCGGTAAACTCGAGTTTACCGCATTTCTAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018006.4-1632s21c1
Sequence:CCGGAGAGATGGATCTGCTAGAAGGCTCGAGCCTTCTAGCAGATCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-1079s21c1
Sequence:CCGGCCTCGACCTGGTCACTTTATTCTCGAGAATAAAGTGACCAGGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018006.4-779s21c1
Sequence:CCGGTTTGAGCAGAAGCACGTTAAGCTCGAGCTTAACGTGCTTCTGCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018006.2-772s1c1
Sequence:CCGGCCTGGTCACTTTATTTCCATACTCGAGTATGGAAATAAAGTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018006.2-425s1c1
Sequence:CCGGCAGGTCACTATGCAAGAACTTCTCGAGAAGTTCTTGCATAGTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018006.2-233s1c1
Sequence:CCGGGCCAGATCTTAGACATCCCTTCTCGAGAAGGGATGTCTAAGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks