EMAIL THIS PAGE TO A FRIEND

TRNAU1AP

tRNA selenocysteine 1 associated protein 1

Synonyms: PRO1902 RP4-669K10.4 SECP43 TRSPAP1
UniProtKB ID: Q9NX07, Q86SU7
Gene ID:
Mouse(71787) tRNA selenocysteine 1 associated protein 1
Rat(65241) tRNA selenocysteine 1 associated protein 1
chicken(419597) tRNA selenocysteine 1 associated protein 1
dog(478164) tRNA selenocysteine 1 associated protein 1
domestic cat(101087502) tRNA selenocysteine 1 associated protein 1
domestic guinea pig(100718774) tRNA selenocysteine 1 associated protein 1
naked mole-rat(101718803) tRNA selenocysteine 1 associated protein 1
cow(532582) tRNA selenocysteine 1 associated protein 1
sheep(101102703) tRNA selenocysteine 1 associated protein 1
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017846 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155321 MISSION® esiRNA esiRNA human TRNAU1AP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017846 Rosetta Predictions human pricing
NR_003109 Rosetta Predictions human pricing
NM_023027 Rosetta Predictions rat pricing
NM_027925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087400 predicted 783
2 SASI_Hs01_00087401 predicted 423
3 SASI_Hs01_00087403 predicted 655
4 SASI_Hs01_00087404 predicted 624
5 SASI_Hs02_00350740 predicted 337
6 SASI_Hs01_00087405 predicted 357
7 SASI_Hs02_00350741 predicted 421
8 SASI_Hs02_00350742 predicted 359
9 SASI_Hs01_00087407 predicted 643
10 SASI_Hs01_00087408 predicted 668
11 SASI_Hs01_00087402 predicted 1135
12 SASI_Hs01_00087406 predicted 1171
13 SASI_Hs01_00087409 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378276 predicted 925
2 SASI_Hs02_00378277 predicted 1354
3 SASI_Hs02_00378278 predicted 808
4 SASI_Hs02_00378279 predicted 1498
5 SASI_Hs02_00378280 predicted 1690
6 SASI_Hs02_00378281 predicted 1214
7 SASI_Hs02_00378282 predicted 1466
8 SASI_Hs02_00378283 predicted 1613
9 SASI_Hs02_00378284 predicted 1687
10 SASI_Hs02_00378285 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263718 predicted 328
2 SASI_Rn01_00103116 predicted 262
3 SASI_Rn01_00103117 predicted 412
4 SASI_Rn01_00103118 predicted 530
5 SASI_Rn01_00103119 predicted 326
6 SASI_Rn01_00103120 predicted 561
7 SASI_Rn01_00103121 predicted 250
8 SASI_Rn01_00103122 predicted 579
9 SASI_Rn02_00263719 predicted 416
10 SASI_Rn01_00103124 predicted 416
11 SASI_Rn01_00103123 predicted 408
12 SASI_Rn01_00103125 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046417 predicted 688
2 SASI_Mm01_00046418 predicted 257
3 SASI_Mm01_00046419 predicted 485
4 SASI_Mm01_00046420 predicted 724
5 SASI_Mm01_00046421 predicted 311
6 SASI_Mm01_00046422 predicted 331
7 SASI_Mm02_00332904 predicted 408
8 SASI_Mm01_00046423 predicted 551
9 SASI_Mm01_00046425 predicted 715
10 SASI_Mm02_00332905 predicted 549
11 SASI_Mm01_00046416 predicted 449
12 SASI_Mm01_00046424 predicted 809
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027925
VALIDATED
TRNAU1AP MISSION shRNA Bacterial Glycerol Stock
tRNA selenocysteine 1 associated protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-1003s1c1
Sequence:CCGGGAGGCCTAGAATAATGACCTTCTCGAGAAGGTCATTATTCTAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-524s1c1
Sequence:CCGGCGTGTCTAAGGGCTATGGTTTCTCGAGAAACCATAGCCCTTAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-456s1c1
Sequence:CCGGCTGTATGAGTTCTTTGTCAAACTCGAGTTTGACAAAGAACTCATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027925.2-293s1c1
Sequence:CCGGAGCCGAGAAGTGTTTGCATAACTCGAGTTATGCAAACACTTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-867s1c1
Sequence:CCGGGATGTGACTGAAGCCAACAAACTCGAGTTTGTTGGCTTCAGTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027925
VALIDATED
TRNAU1AP MISSION shRNA shRNA Plasmid DNA
tRNA selenocysteine 1 associated protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-1003s1c1
Sequence:CCGGGAGGCCTAGAATAATGACCTTCTCGAGAAGGTCATTATTCTAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-524s1c1
Sequence:CCGGCGTGTCTAAGGGCTATGGTTTCTCGAGAAACCATAGCCCTTAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-456s1c1
Sequence:CCGGCTGTATGAGTTCTTTGTCAAACTCGAGTTTGACAAAGAACTCATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027925.2-293s1c1
Sequence:CCGGAGCCGAGAAGTGTTTGCATAACTCGAGTTATGCAAACACTTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-867s1c1
Sequence:CCGGGATGTGACTGAAGCCAACAAACTCGAGTTTGTTGGCTTCAGTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027925
VALIDATED
TRNAU1AP MISSION shRNA Lentiviral Transduction Particles
tRNA selenocysteine 1 associated protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-1003s1c1
Sequence:CCGGGAGGCCTAGAATAATGACCTTCTCGAGAAGGTCATTATTCTAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-524s1c1
Sequence:CCGGCGTGTCTAAGGGCTATGGTTTCTCGAGAAACCATAGCCCTTAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-456s1c1
Sequence:CCGGCTGTATGAGTTCTTTGTCAAACTCGAGTTTGACAAAGAACTCATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027925.2-293s1c1
Sequence:CCGGAGCCGAGAAGTGTTTGCATAACTCGAGTTATGCAAACACTTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027925.2-867s1c1
Sequence:CCGGGATGTGACTGAAGCCAACAAACTCGAGTTTGTTGGCTTCAGTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017846
VALIDATED
TRNAU1AP MISSION shRNA Bacterial Glycerol Stock
tRNA selenocysteine 1 associated protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_017846.3-775s1c1
Sequence:CCGGGCCAACAAGGAGTTCATGGAACTCGAGTTCCATGAACTCCTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017846.3-53s1c1
Sequence:CCGGCCTACATGGATGAGAACTTCACTCGAGTGAAGTTCTCATCCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017846.3-272s1c1
Sequence:CCGGCTTACGGGAAACAACCAGATACTCGAGTATCTGGTTGTTTCCCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017846.3-1266s1c1
Sequence:CCGGGCCATATTTGAGTCCTAACTTCTCGAGAAGTTAGGACTCAAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017846.3-1026s1c1
Sequence:CCGGGCTGCATTCATTTGACCATTTCTCGAGAAATGGTCAAATGAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_017846.3-597s1c1
Sequence:CCGGCAACCAGTATTATCAGCAGTACTCGAGTACTGCTGATAATACTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-664s21c1
Sequence:CCGGTTATAGCTACAACCAGTATTACTCGAGTAATACTGGTTGTAGCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-616s21c1
Sequence:CCGGCCCTAAAGCGAGCCGTGTAAACTCGAGTTTACACGGCTCGCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-349s21c1
Sequence:CCGGTTACGGGAAACAACCAGATAACTCGAGTTATCTGGTTGTTTCCCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017846.4-1331s21c1
Sequence:CCGGTTGTAGGACCTGCCATATTTGCTCGAGCAAATATGGCAGGTCCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-492s21c1
Sequence:CCGGCAGGCGTGTCTAAGGGTTATGCTCGAGCATAACCCTTAGACACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017846
VALIDATED
TRNAU1AP MISSION shRNA shRNA Plasmid DNA
tRNA selenocysteine 1 associated protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_017846.3-775s1c1
Sequence:CCGGGCCAACAAGGAGTTCATGGAACTCGAGTTCCATGAACTCCTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017846.3-53s1c1
Sequence:CCGGCCTACATGGATGAGAACTTCACTCGAGTGAAGTTCTCATCCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017846.3-272s1c1
Sequence:CCGGCTTACGGGAAACAACCAGATACTCGAGTATCTGGTTGTTTCCCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017846.3-1266s1c1
Sequence:CCGGGCCATATTTGAGTCCTAACTTCTCGAGAAGTTAGGACTCAAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017846.3-1026s1c1
Sequence:CCGGGCTGCATTCATTTGACCATTTCTCGAGAAATGGTCAAATGAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_017846.3-597s1c1
Sequence:CCGGCAACCAGTATTATCAGCAGTACTCGAGTACTGCTGATAATACTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-664s21c1
Sequence:CCGGTTATAGCTACAACCAGTATTACTCGAGTAATACTGGTTGTAGCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-616s21c1
Sequence:CCGGCCCTAAAGCGAGCCGTGTAAACTCGAGTTTACACGGCTCGCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-349s21c1
Sequence:CCGGTTACGGGAAACAACCAGATAACTCGAGTTATCTGGTTGTTTCCCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017846.4-1331s21c1
Sequence:CCGGTTGTAGGACCTGCCATATTTGCTCGAGCAAATATGGCAGGTCCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-492s21c1
Sequence:CCGGCAGGCGTGTCTAAGGGTTATGCTCGAGCATAACCCTTAGACACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017846
VALIDATED
TRNAU1AP MISSION shRNA Lentiviral Transduction Particles
tRNA selenocysteine 1 associated protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_017846.3-775s1c1
Sequence:CCGGGCCAACAAGGAGTTCATGGAACTCGAGTTCCATGAACTCCTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017846.3-53s1c1
Sequence:CCGGCCTACATGGATGAGAACTTCACTCGAGTGAAGTTCTCATCCATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017846.3-272s1c1
Sequence:CCGGCTTACGGGAAACAACCAGATACTCGAGTATCTGGTTGTTTCCCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017846.3-1266s1c1
Sequence:CCGGGCCATATTTGAGTCCTAACTTCTCGAGAAGTTAGGACTCAAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017846.3-1026s1c1
Sequence:CCGGGCTGCATTCATTTGACCATTTCTCGAGAAATGGTCAAATGAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_017846.3-597s1c1
Sequence:CCGGCAACCAGTATTATCAGCAGTACTCGAGTACTGCTGATAATACTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-664s21c1
Sequence:CCGGTTATAGCTACAACCAGTATTACTCGAGTAATACTGGTTGTAGCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-616s21c1
Sequence:CCGGCCCTAAAGCGAGCCGTGTAAACTCGAGTTTACACGGCTCGCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-349s21c1
Sequence:CCGGTTACGGGAAACAACCAGATAACTCGAGTTATCTGGTTGTTTCCCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017846.4-1331s21c1
Sequence:CCGGTTGTAGGACCTGCCATATTTGCTCGAGCAAATATGGCAGGTCCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017846.4-492s21c1
Sequence:CCGGCAGGCGTGTCTAAGGGTTATGCTCGAGCATAACCCTTAGACACGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks