EMAIL THIS PAGE TO A FRIEND

TRNP1

TMF1-regulated nuclear protein 1

Synonyms: C1orf225 TNRP
UniProtKB ID: Q6NT89
Gene ID:
Mouse(69539) TMF1-regulated nuclear protein 1
Rat(688990) TMF1-regulated nuclear protein 1
cow(614290) TMF1-regulated nuclear protein 1
naked mole-rat(101723471) TMF1-regulated nuclear protein 1
dog(612117) TMF1-regulated nuclear protein 1
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013642 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013642 Rosetta Predictions human pricing
XM_001069068 Rosetta Predictions rat pricing
NM_001081156 Rosetta Predictions mouse pricing
XM_149530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243155 predicted 986
2 SASI_Hs01_00243156 predicted 974
3 SASI_Hs01_00243157 predicted 993
4 SASI_Hs01_00243158 predicted 990
5 SASI_Hs02_00306413 predicted 1108
6 SASI_Hs02_00306414 predicted 1178
7 SASI_Hs02_00306415 predicted 1115
8 SASI_Hs02_00306416 predicted 1023
9 SASI_Hs02_00306417 predicted 1117
10 SASI_Hs02_00306418 predicted 1183
11 SASI_Hs01_00243159 predicted 989
12 SASI_Hs01_00243160 predicted 971
13 SASI_Hs01_00243161 predicted 987
14 SASI_Hs01_00243162 predicted 977
15 SASI_Hs01_00243163 predicted 979
16 SASI_Hs01_00243164 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326780 predicted 516
2 SASI_Rn02_00326781 predicted 571
3 SASI_Rn02_00326782 predicted 520
4 SASI_Rn02_00326783 predicted 224
5 SASI_Rn02_00326784 predicted 576
6 SASI_Rn02_00326785 predicted 572
7 SASI_Rn02_00326786 predicted 407
8 SASI_Rn02_00326787 predicted 528
9 SASI_Rn02_00326788 predicted 430
10 SASI_Rn02_00326789 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295731 predicted 1183
2 SASI_Mm02_00295732 predicted 1086
3 SASI_Mm02_00295733 predicted 1238
4 SASI_Mm02_00295734 predicted 1209
5 SASI_Mm02_00295735 predicted 1163
6 SASI_Mm02_00295736 predicted 1227
7 SASI_Mm02_00295737 predicted 1099
8 SASI_Mm02_00295738 predicted 1089
9 SASI_Mm02_00295739 predicted 1114
10 SASI_Mm02_00295740 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_149530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232242 predicted 1046
2 SASI_Mm01_00232243 predicted 1113
3 SASI_Mm01_00232244 predicted 1197
4 SASI_Mm01_00232245 predicted 1099
5 SASI_Mm01_00232246 predicted 1247
6 SASI_Mm01_00232247 predicted 1218
7 SASI_Mm01_00232248 predicted 1169
8 SASI_Mm01_00232249 predicted 1237
9 SASI_Mm01_00232250 predicted 935
10 SASI_Mm01_00232251 predicted 848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081156
TRNP1 MISSION shRNA Bacterial Glycerol Stock
TMF1-regulated nuclear protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081156.2-1114s21c1
Sequence:CCGGTGTATTTGCCTTTGCTGATACCTCGAGGTATCAGCAAAGGCAAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081156.2-1082s21c1
Sequence:CCGGACTTGCTCCACTCTGCATTGCCTCGAGGCAATGCAGAGTGGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081156.2-464s21c1
Sequence:CCGGTGCAGCTGCACCGAGTCTTCTCTCGAGAGAAGACTCGGTGCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081156.2-1100s21c1
Sequence:CCGGTGCTTCCCATACACTGTATTTCTCGAGAAATACAGTGTATGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081156.2-233s21c1
Sequence:CCGGCCACTAAGTCACCGCCCTTACCTCGAGGTAAGGGCGGTGACTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081156
TRNP1 MISSION shRNA shRNA Plasmid DNA
TMF1-regulated nuclear protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081156.2-1114s21c1
Sequence:CCGGTGTATTTGCCTTTGCTGATACCTCGAGGTATCAGCAAAGGCAAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081156.2-1082s21c1
Sequence:CCGGACTTGCTCCACTCTGCATTGCCTCGAGGCAATGCAGAGTGGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081156.2-464s21c1
Sequence:CCGGTGCAGCTGCACCGAGTCTTCTCTCGAGAGAAGACTCGGTGCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081156.2-1100s21c1
Sequence:CCGGTGCTTCCCATACACTGTATTTCTCGAGAAATACAGTGTATGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081156.2-233s21c1
Sequence:CCGGCCACTAAGTCACCGCCCTTACCTCGAGGTAAGGGCGGTGACTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081156
TRNP1 MISSION shRNA Lentiviral Transduction Particles
TMF1-regulated nuclear protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081156.2-1114s21c1
Sequence:CCGGTGTATTTGCCTTTGCTGATACCTCGAGGTATCAGCAAAGGCAAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081156.2-1082s21c1
Sequence:CCGGACTTGCTCCACTCTGCATTGCCTCGAGGCAATGCAGAGTGGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081156.2-464s21c1
Sequence:CCGGTGCAGCTGCACCGAGTCTTCTCTCGAGAGAAGACTCGGTGCAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081156.2-1100s21c1
Sequence:CCGGTGCTTCCCATACACTGTATTTCTCGAGAAATACAGTGTATGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081156.2-233s21c1
Sequence:CCGGCCACTAAGTCACCGCCCTTACCTCGAGGTAAGGGCGGTGACTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013642
VALIDATED
TRNP1 MISSION shRNA Bacterial Glycerol Stock
TMF1-regulated nuclear protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013642.2-1771s21c1
Sequence:CCGGGTGTCTATTATGGCTCTTTAACTCGAGTTAAAGAGCCATAATAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013642.2-1161s21c1
Sequence:CCGGCCTGAGATGCAATCAGATTAACTCGAGTTAATCTGATTGCATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013642.2-998s21c1
Sequence:CCGGGAGAATTGACCTTACACAATCCTCGAGGATTGTGTAAGGTCAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013642.2-1272s21c1
Sequence:CCGGAGATATCGTCATCATTCTTAACTCGAGTTAAGAATGATGACGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013642.2-1335s21c1
Sequence:CCGGTGTCATTGCTTCAAGTCTAACCTCGAGGTTAGACTTGAAGCAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013642.1-1082s1c1
Sequence:CCGGGATGCTCTGAATTTCTTCATACTCGAGTATGAAGAAATTCAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013642.1-1167s1c1
Sequence:CCGGCAATCAGATTAAGCGTAGCAACTCGAGTTGCTACGCTTAATCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013642
VALIDATED
TRNP1 MISSION shRNA shRNA Plasmid DNA
TMF1-regulated nuclear protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013642.2-1771s21c1
Sequence:CCGGGTGTCTATTATGGCTCTTTAACTCGAGTTAAAGAGCCATAATAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013642.2-1161s21c1
Sequence:CCGGCCTGAGATGCAATCAGATTAACTCGAGTTAATCTGATTGCATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013642.2-998s21c1
Sequence:CCGGGAGAATTGACCTTACACAATCCTCGAGGATTGTGTAAGGTCAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013642.2-1272s21c1
Sequence:CCGGAGATATCGTCATCATTCTTAACTCGAGTTAAGAATGATGACGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013642.2-1335s21c1
Sequence:CCGGTGTCATTGCTTCAAGTCTAACCTCGAGGTTAGACTTGAAGCAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013642.1-1082s1c1
Sequence:CCGGGATGCTCTGAATTTCTTCATACTCGAGTATGAAGAAATTCAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013642.1-1167s1c1
Sequence:CCGGCAATCAGATTAAGCGTAGCAACTCGAGTTGCTACGCTTAATCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013642
VALIDATED
TRNP1 MISSION shRNA Lentiviral Transduction Particles
TMF1-regulated nuclear protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013642.2-1771s21c1
Sequence:CCGGGTGTCTATTATGGCTCTTTAACTCGAGTTAAAGAGCCATAATAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013642.2-1161s21c1
Sequence:CCGGCCTGAGATGCAATCAGATTAACTCGAGTTAATCTGATTGCATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013642.2-998s21c1
Sequence:CCGGGAGAATTGACCTTACACAATCCTCGAGGATTGTGTAAGGTCAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013642.2-1272s21c1
Sequence:CCGGAGATATCGTCATCATTCTTAACTCGAGTTAAGAATGATGACGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013642.2-1335s21c1
Sequence:CCGGTGTCATTGCTTCAAGTCTAACCTCGAGGTTAGACTTGAAGCAATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013642.1-1082s1c1
Sequence:CCGGGATGCTCTGAATTTCTTCATACTCGAGTATGAAGAAATTCAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013642.1-1167s1c1
Sequence:CCGGCAATCAGATTAAGCGTAGCAACTCGAGTTGCTACGCTTAATCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks