EMAIL THIS PAGE TO A FRIEND

TRNT1

tRNA nucleotidyl transferase, CCA-adding, 1

Synonyms: CCA1 MtCCA
Gene ID:
Human(51095) Summary: The CCA-adding enzyme TRNT1 (EC 2.7.7.25) is an essential enzyme that catalyzes the addition of the CCA terminus to the 3-prime end of tRNA precursors. This reaction is a fundamental prerequisite for mature tRNAs to become aminoacylated and to participate in protein biosynthesis (Lizano et al., 2007 [PubMed 17204286]
Mouse(70047) tRNA nucleotidyl transferase, CCA-adding, 1
Rat(312616) tRNA nucleotidyl transferase, CCA-adding, 1
cow(407144) tRNA nucleotidyl transferase, CCA-adding, 1
sheep(101111583) tRNA nucleotidyl transferase, CCA-adding, 1
domestic guinea pig(100735013) tRNA nucleotidyl transferase, CCA-adding, 1
naked mole-rat(101701523) tRNA nucleotidyl transferase, CCA-adding, 1
Zebrafish(415249) tRNA nucleotidyl transferase, CCA-adding, 1
dog(476552) tRNA nucleotidyl transferase, CCA-adding, 1
Horse(100053009) tRNA nucleotidyl transferase, CCA-adding, 1
domestic cat(101097797) tRNA nucleotidyl transferase, CCA-adding, 1
chicken(416103) tRNA nucleotidyl transferase, CCA-adding, 1
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40819 Anti-TRNT1 antibody produced in rabbit IgG fraction of antiserum , zebrafish, mouse, bovine, human, guinea pig, horse, canine, rat, rabbit
immunohistochemistry, western blot pricing
HPA036938 Anti-TRNT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1403230 Monoclonal Anti-TRNT1 antibody produced in mouse clone 1G11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016000 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027296 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027296 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027296 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016000 Rosetta Predictions human pricing
NM_182916 Rosetta Predictions human pricing
NM_001024261 Rosetta Predictions rat pricing
NM_027296 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167516 predicted 266
2 SASI_Hs01_00167517 predicted 426
3 SASI_Hs01_00167518 predicted 1092
4 SASI_Hs01_00167519 predicted 381
5 SASI_Hs01_00167520 predicted 251
6 SASI_Hs01_00167521 predicted 510
7 SASI_Hs01_00167522 predicted 1088
8 SASI_Hs01_00167523 predicted 1064
9 SASI_Hs01_00167524 predicted 1079
10 SASI_Hs01_00167525 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371028 predicted 553
2 SASI_Hs01_00089079 predicted 310
3 SASI_Hs02_00371029 predicted 882
4 SASI_Hs01_00089082 predicted 421
5 SASI_Hs02_00371030 predicted 988
6 SASI_Hs02_00371031 predicted 840
7 SASI_Hs02_00371032 predicted 725
8 SASI_Hs01_00089085 predicted 1138
9 SASI_Hs01_00089086 predicted 1107
10 SASI_Hs01_00089087 predicted 1119
11 SASI_Hs01_00089080 predicted 440
12 SASI_Hs01_00089081 predicted 1042
13 SASI_Hs01_00089083 predicted 262
14 SASI_Hs01_00089084 predicted 529
15 SASI_Hs01_00089088 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031964 predicted 1097
2 SASI_Rn01_00031965 predicted 1425
3 SASI_Rn01_00031966 predicted 1361
4 SASI_Rn01_00031968 predicted 528
5 SASI_Rn02_00202424 predicted 479
6 SASI_Rn01_00031970 predicted 869
7 SASI_Rn02_00202425 predicted 588
8 SASI_Rn01_00031971 predicted 1158
9 SASI_Rn02_00202426 predicted 249
10 SASI_Rn01_00031973 predicted 1124
11 SASI_Rn01_00031967 predicted 1402
12 SASI_Rn01_00031969 predicted 389
13 SASI_Rn01_00031972 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100234 predicted 370
2 SASI_Mm02_00331904 predicted 1371
3 SASI_Mm01_00100235 predicted 585
4 SASI_Mm02_00331905 predicted 546
5 SASI_Mm01_00100236 predicted 491
6 SASI_Mm01_00100237 predicted 361
7 SASI_Mm01_00100238 predicted 477
8 SASI_Mm01_00100239 predicted 416
9 SASI_Mm01_00100240 predicted 364
10 SASI_Mm02_00331906 predicted 687
11 SASI_Mm01_00100241 predicted 542
12 SASI_Mm01_00100242 predicted 510
13 SASI_Mm01_00100243 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016000
VALIDATED
TRNT1 MISSION shRNA Bacterial Glycerol Stock
tRNA nucleotidyl transferase, CCA-adding, 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-308s1c1
Sequence:CCGGCCCTACTCAAATGAAGGAGATCTCGAGATCTCCTTCATTTGAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-1198s1c1
Sequence:CCGGCCATTCCTCCATTTCCTGTAACTCGAGTTACAGGAAATGGAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-1086s1c1
Sequence:CCGGCCCTATCAAGACTTCATTATACTCGAGTATAATGAAGTCTTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-942s1c1
Sequence:CCGGGCCTCATTATTCAAAGTACAACTCGAGTTGTACTTTGAATAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_016000.2-501s1c1
Sequence:CCGGCGCAGAGATCTCACTATAAATCTCGAGATTTATAGTGAGATCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016000
VALIDATED
TRNT1 MISSION shRNA shRNA Plasmid DNA
tRNA nucleotidyl transferase, CCA-adding, 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-308s1c1
Sequence:CCGGCCCTACTCAAATGAAGGAGATCTCGAGATCTCCTTCATTTGAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-1198s1c1
Sequence:CCGGCCATTCCTCCATTTCCTGTAACTCGAGTTACAGGAAATGGAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-1086s1c1
Sequence:CCGGCCCTATCAAGACTTCATTATACTCGAGTATAATGAAGTCTTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-942s1c1
Sequence:CCGGGCCTCATTATTCAAAGTACAACTCGAGTTGTACTTTGAATAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_016000.2-501s1c1
Sequence:CCGGCGCAGAGATCTCACTATAAATCTCGAGATTTATAGTGAGATCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016000
VALIDATED
TRNT1 MISSION shRNA Lentiviral Transduction Particles
tRNA nucleotidyl transferase, CCA-adding, 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-308s1c1
Sequence:CCGGCCCTACTCAAATGAAGGAGATCTCGAGATCTCCTTCATTTGAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-1198s1c1
Sequence:CCGGCCATTCCTCCATTTCCTGTAACTCGAGTTACAGGAAATGGAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-1086s1c1
Sequence:CCGGCCCTATCAAGACTTCATTATACTCGAGTATAATGAAGTCTTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016000.2-942s1c1
Sequence:CCGGGCCTCATTATTCAAAGTACAACTCGAGTTGTACTTTGAATAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_016000.2-501s1c1
Sequence:CCGGCGCAGAGATCTCACTATAAATCTCGAGATTTATAGTGAGATCTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027296
VALIDATED
TRNT1 MISSION shRNA Bacterial Glycerol Stock
tRNA nucleotidyl transferase, CCA-adding, 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027296.1-2080s1c1
Sequence:CCGGGCCCTGTGTTTATCTCCTTTACTCGAGTAAAGGAGATAAACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027296.1-118s1c1
Sequence:CCGGGCGATACCTGTTTACAATGAACTCGAGTTCATTGTAAACAGGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027296.1-186s1c1
Sequence:CCGGGCCTGACAGAATTATTTGCCACTCGAGTGGCAAATAATTCTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027296.1-422s1c1
Sequence:CCGGCGAATTGATGTTACCACTGATCTCGAGATCAGTGGTAACATCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027296.1-842s1c1
Sequence:CCGGCACATAGGTTTACCTGCTAATCTCGAGATTAGCAGGTAAACCTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-86s21c1
Sequence:CCGGAGGTGTAGTTGGAGTAGATTGCTCGAGCAATCTACTCCAACTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-1722s21c1
Sequence:CCGGACAGGAGGTTGGCAGATATTCCTCGAGGAATATCTGCCAACCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-555s21c1
Sequence:CCGGTCAATGGTTATGCAGATTTAACTCGAGTTAAATCTGCATAACCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-493s21c1
Sequence:CCGGACGAAGAGATCTCACTATAAACTCGAGTTTATAGTGAGATCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027296.2-118s21c1
Sequence:CCGGGCGATACCTGTTTACAATGAACTCGAGTTCATTGTAAACAGGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-804s21c1
Sequence:CCGGATTTGATCCACCTGATCTATGCTCGAGCATAGATCAGGTGGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027296
VALIDATED
TRNT1 MISSION shRNA shRNA Plasmid DNA
tRNA nucleotidyl transferase, CCA-adding, 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027296.1-2080s1c1
Sequence:CCGGGCCCTGTGTTTATCTCCTTTACTCGAGTAAAGGAGATAAACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027296.1-118s1c1
Sequence:CCGGGCGATACCTGTTTACAATGAACTCGAGTTCATTGTAAACAGGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027296.1-186s1c1
Sequence:CCGGGCCTGACAGAATTATTTGCCACTCGAGTGGCAAATAATTCTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027296.1-422s1c1
Sequence:CCGGCGAATTGATGTTACCACTGATCTCGAGATCAGTGGTAACATCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027296.1-842s1c1
Sequence:CCGGCACATAGGTTTACCTGCTAATCTCGAGATTAGCAGGTAAACCTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-86s21c1
Sequence:CCGGAGGTGTAGTTGGAGTAGATTGCTCGAGCAATCTACTCCAACTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-1722s21c1
Sequence:CCGGACAGGAGGTTGGCAGATATTCCTCGAGGAATATCTGCCAACCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-555s21c1
Sequence:CCGGTCAATGGTTATGCAGATTTAACTCGAGTTAAATCTGCATAACCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-493s21c1
Sequence:CCGGACGAAGAGATCTCACTATAAACTCGAGTTTATAGTGAGATCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027296.2-118s21c1
Sequence:CCGGGCGATACCTGTTTACAATGAACTCGAGTTCATTGTAAACAGGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-804s21c1
Sequence:CCGGATTTGATCCACCTGATCTATGCTCGAGCATAGATCAGGTGGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027296
VALIDATED
TRNT1 MISSION shRNA Lentiviral Transduction Particles
tRNA nucleotidyl transferase, CCA-adding, 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027296.1-2080s1c1
Sequence:CCGGGCCCTGTGTTTATCTCCTTTACTCGAGTAAAGGAGATAAACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027296.1-118s1c1
Sequence:CCGGGCGATACCTGTTTACAATGAACTCGAGTTCATTGTAAACAGGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027296.1-186s1c1
Sequence:CCGGGCCTGACAGAATTATTTGCCACTCGAGTGGCAAATAATTCTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027296.1-422s1c1
Sequence:CCGGCGAATTGATGTTACCACTGATCTCGAGATCAGTGGTAACATCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027296.1-842s1c1
Sequence:CCGGCACATAGGTTTACCTGCTAATCTCGAGATTAGCAGGTAAACCTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-86s21c1
Sequence:CCGGAGGTGTAGTTGGAGTAGATTGCTCGAGCAATCTACTCCAACTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-1722s21c1
Sequence:CCGGACAGGAGGTTGGCAGATATTCCTCGAGGAATATCTGCCAACCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-555s21c1
Sequence:CCGGTCAATGGTTATGCAGATTTAACTCGAGTTAAATCTGCATAACCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-493s21c1
Sequence:CCGGACGAAGAGATCTCACTATAAACTCGAGTTTATAGTGAGATCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027296.2-118s21c1
Sequence:CCGGGCGATACCTGTTTACAATGAACTCGAGTTCATTGTAAACAGGTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027296.2-804s21c1
Sequence:CCGGATTTGATCCACCTGATCTATGCTCGAGCATAGATCAGGTGGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks