EMAIL THIS PAGE TO A FRIEND

TRO

trophinin

Synonyms: MAGE-d3 MAGED3
UniProtKB ID: Q12816, Q96SX2, Q9NU89, Q9UPN8
Gene ID:
Human(7216) Summary: This gene encodes a membrane protein that mediates cell adhesion between trophoblastic cells and the epithelial cells of the endometrium. The encoded protein participates in cell signalling during embryo implantation, and may also be involved in cancer formation. This gene is located near several other closely related genes on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Mouse(56191) trophinin
Rat(100912175) trophinin
Thale Cress(841570) protein TRAUCO
dog(612655) trophinin
cow(533525) trophinin
186 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA053358 Anti-TRO antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177556 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177557 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039705 Rosetta Predictions human pricing
NM_016157 Rosetta Predictions human pricing
NM_177556 Rosetta Predictions human pricing
NM_001002272 Rosetta Predictions mouse pricing
NM_019548 Rosetta Predictions mouse pricing
NM_207679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115138 predicted 286
2 SASI_Hs01_00115139 predicted 916
3 SASI_Hs01_00115141 predicted 1459
4 SASI_Hs01_00115142 predicted 513
5 SASI_Hs01_00115143 predicted 1073
6 SASI_Hs01_00115144 predicted 883
7 SASI_Hs01_00115145 predicted 720
8 SASI_Hs01_00115146 predicted 722
9 SASI_Hs01_00115147 predicted 414
10 SASI_Hs02_00308646 predicted 1139
11 SASI_Hs01_00115140 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210603 predicted 287
2 SASI_Hs01_00210604 predicted 922
3 SASI_Hs01_00210606 predicted 1451
4 SASI_Hs01_00210607 predicted 514
5 SASI_Hs01_00210608 predicted 1069
6 SASI_Hs01_00210609 predicted 889
7 SASI_Hs01_00210610 predicted 727
8 SASI_Hs01_00210611 predicted 719
9 SASI_Hs01_00210612 predicted 417
10 SASI_Hs02_00348963 predicted 1139
11 SASI_Hs01_00210605 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123269 predicted 272
2 SASI_Hs01_00123270 predicted 906
3 SASI_Hs01_00123272 predicted 1443
4 SASI_Hs01_00123273 predicted 506
5 SASI_Hs01_00123274 predicted 1058
6 SASI_Hs01_00123275 predicted 876
7 SASI_Hs01_00123276 predicted 710
8 SASI_Hs01_00123277 predicted 706
9 SASI_Hs01_00123278 predicted 402
10 SASI_Hs02_00369404 predicted 1128
11 SASI_Hs01_00123271 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054401 predicted 412
2 SASI_Mm01_00054402 predicted 1783
3 SASI_Mm02_00286291 predicted 2155
4 SASI_Mm01_00054403 predicted 267
5 SASI_Mm01_00054404 predicted 361
6 SASI_Mm01_00054405 predicted 1723
7 SASI_Mm01_00054406 predicted 1549
8 SASI_Mm01_00054407 predicted 657
9 SASI_Mm02_00286292 predicted 1065
10 SASI_Mm01_00054409 predicted 238
11 SASI_Mm01_00054400 predicted 1176
12 SASI_Mm01_00054408 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058415 predicted 412
2 SASI_Mm01_00058416 predicted 1783
3 SASI_Mm02_00324590 predicted 2160
4 SASI_Mm01_00058417 predicted 265
5 SASI_Mm01_00058418 predicted 361
6 SASI_Mm01_00058419 predicted 1719
7 SASI_Mm01_00058420 predicted 1546
8 SASI_Mm01_00058421 predicted 658
9 SASI_Mm02_00324591 predicted 1067
10 SASI_Mm01_00058423 predicted 237
11 SASI_Mm01_00058414 predicted 1173
12 SASI_Mm01_00058422 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166094 predicted 1178
2 SASI_Mm01_00166095 predicted 376
3 SASI_Mm01_00166096 predicted 1749
4 SASI_Mm01_00166097 predicted 238
5 SASI_Mm01_00166098 predicted 331
6 SASI_Mm01_00166099 predicted 1687
7 SASI_Mm01_00166100 predicted 1519
8 SASI_Mm01_00166101 predicted 626
9 SASI_Mm01_00166102 predicted 234
10 SASI_Mm01_00166103 predicted 204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019548
TRO MISSION shRNA Bacterial Glycerol Stock
trophinin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019548.3-2104s21c1
Sequence:CCGGGAGTCATCTGCAGGCATAATGCTCGAGCATTATGCCTGCAGATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019548.3-565s21c1
Sequence:CCGGCCAGTTACCACACCGACTATCCTCGAGGATAGTCGGTGTGGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019548.2-3020s1c1
Sequence:CCGGCCCTGTTTACAGATAACGCTACTCGAGTAGCGTTATCTGTAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-1129s1c1
Sequence:CCGGGCAGACAGATTGAGGCATCTACTCGAGTAGATGCCTCAATCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-1746s1c1
Sequence:CCGGCGAAAGTCTAAGCATCCCAATCTCGAGATTGGGATGCTTAGACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-622s1c1
Sequence:CCGGCGGCAAACAATGCTGCCAATACTCGAGTATTGGCAGCATTGTTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-335s1c1
Sequence:CCGGGCAGGCTTTAAACCTACCAATCTCGAGATTGGTAGGTTTAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019548
TRO MISSION shRNA shRNA Plasmid DNA
trophinin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019548.3-2104s21c1
Sequence:CCGGGAGTCATCTGCAGGCATAATGCTCGAGCATTATGCCTGCAGATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019548.3-565s21c1
Sequence:CCGGCCAGTTACCACACCGACTATCCTCGAGGATAGTCGGTGTGGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019548.2-3020s1c1
Sequence:CCGGCCCTGTTTACAGATAACGCTACTCGAGTAGCGTTATCTGTAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-1129s1c1
Sequence:CCGGGCAGACAGATTGAGGCATCTACTCGAGTAGATGCCTCAATCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-1746s1c1
Sequence:CCGGCGAAAGTCTAAGCATCCCAATCTCGAGATTGGGATGCTTAGACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-622s1c1
Sequence:CCGGCGGCAAACAATGCTGCCAATACTCGAGTATTGGCAGCATTGTTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-335s1c1
Sequence:CCGGGCAGGCTTTAAACCTACCAATCTCGAGATTGGTAGGTTTAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019548
TRO MISSION shRNA Lentiviral Transduction Particles
trophinin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019548.3-2104s21c1
Sequence:CCGGGAGTCATCTGCAGGCATAATGCTCGAGCATTATGCCTGCAGATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019548.3-565s21c1
Sequence:CCGGCCAGTTACCACACCGACTATCCTCGAGGATAGTCGGTGTGGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019548.2-3020s1c1
Sequence:CCGGCCCTGTTTACAGATAACGCTACTCGAGTAGCGTTATCTGTAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-1129s1c1
Sequence:CCGGGCAGACAGATTGAGGCATCTACTCGAGTAGATGCCTCAATCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-1746s1c1
Sequence:CCGGCGAAAGTCTAAGCATCCCAATCTCGAGATTGGGATGCTTAGACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-622s1c1
Sequence:CCGGCGGCAAACAATGCTGCCAATACTCGAGTATTGGCAGCATTGTTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019548.2-335s1c1
Sequence:CCGGGCAGGCTTTAAACCTACCAATCTCGAGATTGGTAGGTTTAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177556
VALIDATED
TRO MISSION shRNA Bacterial Glycerol Stock
trophinin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177556.1-1604s21c1
Sequence:CCGGTGATAAGCAAAGTAGCTTGTACTCGAGTACAAGCTACTTTGCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177556.1-879s21c1
Sequence:CCGGACAATTGCTAAGGTCATAAATCTCGAGATTTATGACCTTAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177556.1-594s21c1
Sequence:CCGGTCACCCTTGCAGGTCCTAAAGCTCGAGCTTTAGGACCTGCAAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177556.1-1422s21c1
Sequence:CCGGTTACAAGAAAGGGCTAATAAGCTCGAGCTTATTAGCCCTTTCTTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177556.1-787s21c1
Sequence:CCGGCTACCACCCAAGGCCAAATTACTCGAGTAATTTGGCCTTGGGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177556
VALIDATED
TRO MISSION shRNA shRNA Plasmid DNA
trophinin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177556.1-1604s21c1
Sequence:CCGGTGATAAGCAAAGTAGCTTGTACTCGAGTACAAGCTACTTTGCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177556.1-879s21c1
Sequence:CCGGACAATTGCTAAGGTCATAAATCTCGAGATTTATGACCTTAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177556.1-594s21c1
Sequence:CCGGTCACCCTTGCAGGTCCTAAAGCTCGAGCTTTAGGACCTGCAAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177556.1-1422s21c1
Sequence:CCGGTTACAAGAAAGGGCTAATAAGCTCGAGCTTATTAGCCCTTTCTTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177556.1-787s21c1
Sequence:CCGGCTACCACCCAAGGCCAAATTACTCGAGTAATTTGGCCTTGGGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177556
VALIDATED
TRO MISSION shRNA Lentiviral Transduction Particles
trophinin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177556.1-1604s21c1
Sequence:CCGGTGATAAGCAAAGTAGCTTGTACTCGAGTACAAGCTACTTTGCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177556.1-879s21c1
Sequence:CCGGACAATTGCTAAGGTCATAAATCTCGAGATTTATGACCTTAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177556.1-594s21c1
Sequence:CCGGTCACCCTTGCAGGTCCTAAAGCTCGAGCTTTAGGACCTGCAAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177556.1-1422s21c1
Sequence:CCGGTTACAAGAAAGGGCTAATAAGCTCGAGCTTATTAGCCCTTTCTTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177556.1-787s21c1
Sequence:CCGGCTACCACCCAAGGCCAAATTACTCGAGTAATTTGGCCTTGGGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177557
VALIDATED
TRO MISSION shRNA Bacterial Glycerol Stock
trophinin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-393s1c1
Sequence:CCGGCGAGTCAATCTGAAAGAAATTCTCGAGAATTTCTTTCAGATTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-897s1c1
Sequence:CCGGCCATGTTTACAGATACCGCTACTCGAGTAGCGGTATCTGTAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-900s1c1
Sequence:CCGGTGTTTACAGATACCGCTAATACTCGAGTATTAGCGGTATCTGTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177557.1-413s1c1
Sequence:CCGGTGATAAGCAAAGTAGCTTGTACTCGAGTACAAGCTACTTTGCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-266s1c1
Sequence:CCGGGTTGGTTAAGGACCAGACAAACTCGAGTTTGTCTGGTCCTTAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177557
VALIDATED
TRO MISSION shRNA shRNA Plasmid DNA
trophinin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-393s1c1
Sequence:CCGGCGAGTCAATCTGAAAGAAATTCTCGAGAATTTCTTTCAGATTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-897s1c1
Sequence:CCGGCCATGTTTACAGATACCGCTACTCGAGTAGCGGTATCTGTAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-900s1c1
Sequence:CCGGTGTTTACAGATACCGCTAATACTCGAGTATTAGCGGTATCTGTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177557.1-413s1c1
Sequence:CCGGTGATAAGCAAAGTAGCTTGTACTCGAGTACAAGCTACTTTGCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-266s1c1
Sequence:CCGGGTTGGTTAAGGACCAGACAAACTCGAGTTTGTCTGGTCCTTAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177557
VALIDATED
TRO MISSION shRNA Lentiviral Transduction Particles
trophinin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-393s1c1
Sequence:CCGGCGAGTCAATCTGAAAGAAATTCTCGAGAATTTCTTTCAGATTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-897s1c1
Sequence:CCGGCCATGTTTACAGATACCGCTACTCGAGTAGCGGTATCTGTAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-900s1c1
Sequence:CCGGTGTTTACAGATACCGCTAATACTCGAGTATTAGCGGTATCTGTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177557.1-413s1c1
Sequence:CCGGTGATAAGCAAAGTAGCTTGTACTCGAGTACAAGCTACTTTGCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177557.1-266s1c1
Sequence:CCGGGTTGGTTAAGGACCAGACAAACTCGAGTTTGTCTGGTCCTTAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks