EMAIL THIS PAGE TO A FRIEND

TROAP

trophinin associated protein

Synonyms: TASTIN
UniProtKB ID: Q12815, Q6PJU7, Q8N5B2
Gene ID:
Mouse(78733) trophinin associated protein
Rat(300219) trophinin associated protein
naked mole-rat(101714251) trophinin associated protein
domestic guinea pig(100715914) trophinin associated protein
cow(505791) trophinin associated protein (tastin)
sheep(101119203) trophinin associated protein
Horse(100059286) trophinin associated protein
domestic cat(101082500) trophinin associated protein
dog(608844) trophinin associated protein
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005480 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001162506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100620 Rosetta Predictions human pricing
NM_005480 Rosetta Predictions human pricing
XM_001063086 Rosetta Predictions rat pricing
XM_238523 Rosetta Predictions rat pricing
XM_283286 Rosetta Predictions mouse pricing
XM_912265 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322264 predicted 238
2 SASI_Hs02_00322265 predicted 217
3 SASI_Hs02_00322266 predicted 221
4 SASI_Hs02_00322267 predicted 232
5 SASI_Hs02_00322268 predicted 240
6 SASI_Hs02_00322269 predicted 230
7 SASI_Hs02_00322270 predicted 276
8 SASI_Hs02_00322271 predicted 272
9 SASI_Hs02_00322272 predicted 321
10 SASI_Hs02_00322273 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339660 predicted 243
2 SASI_Hs02_00339661 predicted 222
3 SASI_Hs02_00339662 predicted 226
4 SASI_Hs02_00339663 predicted 232
5 SASI_Hs02_00339664 predicted 232
6 SASI_Hs02_00339665 predicted 231
7 SASI_Hs02_00339666 predicted 272
8 SASI_Hs02_00339667 predicted 271
9 SASI_Hs01_00166707 predicted 322
10 SASI_Hs01_00166708 predicted 1526
11 SASI_Hs01_00166709 predicted 783
12 SASI_Hs01_00166710 predicted 259
13 SASI_Hs01_00166711 predicted 1090
14 SASI_Hs01_00166712 predicted 261
15 SASI_Hs01_00166713 predicted 1287
16 SASI_Hs01_00166714 predicted 1542
17 SASI_Hs01_00166715 predicted 1532
18 SASI_Hs01_00166716 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305738 predicted 639
2 SASI_Rn02_00305739 predicted 1857
3 SASI_Rn02_00305740 predicted 486
4 SASI_Rn02_00305741 predicted 919
5 SASI_Rn02_00305742 predicted 860
6 SASI_Rn02_00305743 predicted 379
7 SASI_Rn02_00305744 predicted 1197
8 SASI_Rn02_00305745 predicted 1036
9 SASI_Rn02_00305746 predicted 1189
10 SASI_Rn02_00305747 predicted 1653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391376 predicted 637
2 SASI_Rn02_00391377 predicted 505
3 SASI_Rn02_00391378 predicted 444
4 SASI_Rn02_00391379 predicted 664
5 SASI_Rn02_00391380 predicted 484
6 SASI_Rn02_00391381 predicted 855
7 SASI_Rn02_00391382 predicted 377
8 SASI_Rn02_00391383 predicted 836
9 SASI_Rn02_00391384 predicted 370
10 SASI_Rn02_00391385 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252195 predicted 1504
2 SASI_Mm01_00252196 predicted 710
3 SASI_Mm01_00252197 predicted 947
4 SASI_Mm01_00252198 predicted 990
5 SASI_Mm02_00425621 predicted 366
6 SASI_Mm02_00425622 predicted 1591
7 SASI_Mm01_00252199 predicted 2069
8 SASI_Mm01_00252200 predicted 1782
9 SASI_Mm01_00252201 predicted 1387
10 SASI_Mm01_00252202 predicted 1382
11 SASI_Mm01_00252194 predicted 1228
12 SASI_Mm01_00252203 predicted 1672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436908 predicted 1500
2 SASI_Mm02_00436909 predicted 711
3 SASI_Mm02_00436910 predicted 946
4 SASI_Mm02_00436911 predicted 998
5 SASI_Mm02_00436912 predicted 364
6 SASI_Mm02_00436913 predicted 1591
7 SASI_Mm02_00436914 predicted 2062
8 SASI_Mm02_00436915 predicted 1783
9 SASI_Mm02_00436916 predicted 1389
10 SASI_Mm02_00436917 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005480
TROAP MISSION shRNA Bacterial Glycerol Stock
trophinin associated protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-1119s1c1
Sequence:CCGGCCTCCAACTCTGACCTCATATCTCGAGATATGAGGTCAGAGTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-1519s1c1
Sequence:CCGGCCCTGCTGACTGAGATTTCTACTCGAGTAGAAATCTCAGTCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-238s1c1
Sequence:CCGGAGAACCAAGATCCAAGGAGATCTCGAGATCTCCTTGGATCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-1887s1c1
Sequence:CCGGTGTAGGATTGAGCCTGAGATACTCGAGTATCTCAGGCTCAATCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-2397s1c1
Sequence:CCGGGCCCTGTGTTTCATTCCAGTTCTCGAGAACTGGAATGAAACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005480
TROAP MISSION shRNA shRNA Plasmid DNA
trophinin associated protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-1119s1c1
Sequence:CCGGCCTCCAACTCTGACCTCATATCTCGAGATATGAGGTCAGAGTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-1519s1c1
Sequence:CCGGCCCTGCTGACTGAGATTTCTACTCGAGTAGAAATCTCAGTCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-238s1c1
Sequence:CCGGAGAACCAAGATCCAAGGAGATCTCGAGATCTCCTTGGATCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-1887s1c1
Sequence:CCGGTGTAGGATTGAGCCTGAGATACTCGAGTATCTCAGGCTCAATCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-2397s1c1
Sequence:CCGGGCCCTGTGTTTCATTCCAGTTCTCGAGAACTGGAATGAAACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005480
TROAP MISSION shRNA Lentiviral Transduction Particles
trophinin associated protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-1119s1c1
Sequence:CCGGCCTCCAACTCTGACCTCATATCTCGAGATATGAGGTCAGAGTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-1519s1c1
Sequence:CCGGCCCTGCTGACTGAGATTTCTACTCGAGTAGAAATCTCAGTCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-238s1c1
Sequence:CCGGAGAACCAAGATCCAAGGAGATCTCGAGATCTCCTTGGATCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-1887s1c1
Sequence:CCGGTGTAGGATTGAGCCTGAGATACTCGAGTATCTCAGGCTCAATCCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005480.2-2397s1c1
Sequence:CCGGGCCCTGTGTTTCATTCCAGTTCTCGAGAACTGGAATGAAACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162506
VALIDATED
TROAP MISSION shRNA Bacterial Glycerol Stock
trophinin associated protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-1275s21c1
Sequence:CCGGTAAGGATACAGCGCATCAATACTCGAGTATTGATGCGCTGTATCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-1037s21c1
Sequence:CCGGATTCGACGGAAAGCCCAATTCCTCGAGGAATTGGGCTTTCCGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162506.1-1155s21c1
Sequence:CCGGAGATTGCTATGAAGTTGTTTGCTCGAGCAAACAACTTCATAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-964s21c1
Sequence:CCGGGGCTCAACGGATACCATTAAACTCGAGTTTAATGGTATCCGTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-1372s21c1
Sequence:CCGGTTTCGATATGACTGAACTAAACTCGAGTTTAGTTCAGTCATATCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162506
VALIDATED
TROAP MISSION shRNA shRNA Plasmid DNA
trophinin associated protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-1275s21c1
Sequence:CCGGTAAGGATACAGCGCATCAATACTCGAGTATTGATGCGCTGTATCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-1037s21c1
Sequence:CCGGATTCGACGGAAAGCCCAATTCCTCGAGGAATTGGGCTTTCCGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162506.1-1155s21c1
Sequence:CCGGAGATTGCTATGAAGTTGTTTGCTCGAGCAAACAACTTCATAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-964s21c1
Sequence:CCGGGGCTCAACGGATACCATTAAACTCGAGTTTAATGGTATCCGTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-1372s21c1
Sequence:CCGGTTTCGATATGACTGAACTAAACTCGAGTTTAGTTCAGTCATATCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162506
VALIDATED
TROAP MISSION shRNA Lentiviral Transduction Particles
trophinin associated protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-1275s21c1
Sequence:CCGGTAAGGATACAGCGCATCAATACTCGAGTATTGATGCGCTGTATCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-1037s21c1
Sequence:CCGGATTCGACGGAAAGCCCAATTCCTCGAGGAATTGGGCTTTCCGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162506.1-1155s21c1
Sequence:CCGGAGATTGCTATGAAGTTGTTTGCTCGAGCAAACAACTTCATAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-964s21c1
Sequence:CCGGGGCTCAACGGATACCATTAAACTCGAGTTTAATGGTATCCGTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001162506.1-1372s21c1
Sequence:CCGGTTTCGATATGACTGAACTAAACTCGAGTTTAGTTCAGTCATATCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks