EMAIL THIS PAGE TO A FRIEND

TROVE2

TROVE domain family, member 2

Synonyms: RO60 RORNP SSA2
Gene ID:
Mouse(20822) TROVE domain family, member 2
Rat(304833) TROVE domain family, member 2
Zebrafish(568429) TROVE domain family, member 2
Horse(100051140) TROVE domain family, member 2
domestic cat(101091674) TROVE domain family, member 2
dog(478957) TROVE domain family, member 2
chicken(424358) TROVE domain family, member 2
cow(518830) TROVE domain family, member 2
sheep(101121278) TROVE domain family, member 2
domestic guinea pig(100714507) TROVE domain family, member 2
naked mole-rat(101697321) TROVE domain family, member 2
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004600 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042369 Rosetta Predictions human pricing
NM_001042370 Rosetta Predictions human pricing
NM_004600 Rosetta Predictions human pricing
NM_001107183 Rosetta Predictions rat pricing
NM_013835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309328 predicted 1576
2 SASI_Hs02_00309329 predicted 1501
3 SASI_Hs02_00309330 predicted 1615
4 SASI_Hs02_00309331 predicted 1693
5 SASI_Hs02_00309332 predicted 1409
6 SASI_Hs02_00309333 predicted 1601
7 SASI_Hs02_00309334 predicted 1661
8 SASI_Hs02_00309335 predicted 1422
9 SASI_Hs02_00309336 predicted 1680
10 SASI_Hs02_00309337 predicted 1438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309338 predicted 504
2 SASI_Hs02_00309339 predicted 438
3 SASI_Hs02_00309340 predicted 548
4 SASI_Hs02_00309341 predicted 627
5 SASI_Hs02_00309342 predicted 537
6 SASI_Hs02_00309343 predicted 594
7 SASI_Hs02_00309344 predicted 350
8 SASI_Hs02_00309345 predicted 611
9 SASI_Hs02_00309346 predicted 366
10 SASI_Hs02_00309347 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337971 predicted 1569
2 SASI_Hs02_00337972 predicted 1495
3 SASI_Hs02_00337973 predicted 1608
4 SASI_Hs01_00213860 predicted 1689
5 SASI_Hs02_00337974 predicted 1412
6 SASI_Hs02_00337975 predicted 1598
7 SASI_Hs02_00337976 predicted 1661
8 SASI_Hs02_00337977 predicted 1422
9 SASI_Hs02_00337978 predicted 1678
10 SASI_Hs02_00337979 predicted 1438
11 SASI_Hs01_00213858 predicted 484
12 SASI_Hs01_00213859 predicted 827
13 SASI_Hs01_00213861 predicted 1042
14 SASI_Hs01_00213862 predicted 1647
15 SASI_Hs01_00213863 predicted 986
16 SASI_Hs01_00213864 predicted 573
17 SASI_Hs01_00213865 predicted 961
18 SASI_Hs01_00213866 predicted 1713
19 SASI_Hs01_00213867 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226325 predicted 760
2 SASI_Rn02_00226326 predicted 1362
3 SASI_Rn02_00226327 predicted 1490
4 SASI_Rn02_00226328 predicted 879
5 SASI_Rn02_00226329 predicted 1020
6 SASI_Rn02_00226330 predicted 731
7 SASI_Rn02_00226331 predicted 1539
8 SASI_Rn02_00226332 predicted 1796
9 SASI_Rn02_00226333 predicted 460
10 SASI_Rn02_00226334 predicted 1828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322821 predicted 1703
2 SASI_Mm02_00322822 predicted 1687
3 SASI_Mm02_00322823 predicted 1016
4 SASI_Mm02_00322824 predicted 1532
5 SASI_Mm02_00322825 predicted 1032
6 SASI_Mm02_00322826 predicted 1092
7 SASI_Mm02_00322827 predicted 730
8 SASI_Mm02_00322828 predicted 423
9 SASI_Mm02_00322829 predicted 1636
10 SASI_Mm02_00322830 predicted 1865
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013835
VALIDATED
TROVE2 MISSION shRNA Bacterial Glycerol Stock
TROVE domain family, member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-1628s21c1
Sequence:CCGGTCCTGCTAAATTGATTGTTTGCTCGAGCAAACAATCAATTTAGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-1651s21c1
Sequence:CCGGGGATGACATCAAATGGCTTTACTCGAGTAAAGCCATTTGATGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-185s21c1
Sequence:CCGGGAGTGAGACTCAAGTAGTTAACTCGAGTTAACTACTTGAGTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-930s21c1
Sequence:CCGGACAAATCACTTGAAGTCTAAACTCGAGTTTAGACTTCAAGTGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013835.2-2220s21c1
Sequence:CCGGATGAACCTCACCAGGTAAATTCTCGAGAATTTACCTGGTGAGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013835.1-386s1c1
Sequence:CCGGGCGGACATAAACACAAAGCAACTCGAGTTGCTTTGTGTTTATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013835.1-1325s1c1
Sequence:CCGGGCCTGTGATATGGTTCCGTTTCTCGAGAAACGGAACCATATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013835.1-1655s1c1
Sequence:CCGGGCTCTGGATGTAATTCGGAATCTCGAGATTCCGAATTACATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013835.1-466s1c1
Sequence:CCGGCCAGTTTAAGAAAGACCTGAACTCGAGTTCAGGTCTTTCTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013835.1-1459s1c1
Sequence:CCGGCGCAGATGTCTTCGTTGTGTTCTCGAGAACACAACGAAGACATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013835
VALIDATED
TROVE2 MISSION shRNA shRNA Plasmid DNA
TROVE domain family, member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-1628s21c1
Sequence:CCGGTCCTGCTAAATTGATTGTTTGCTCGAGCAAACAATCAATTTAGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-1651s21c1
Sequence:CCGGGGATGACATCAAATGGCTTTACTCGAGTAAAGCCATTTGATGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-185s21c1
Sequence:CCGGGAGTGAGACTCAAGTAGTTAACTCGAGTTAACTACTTGAGTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-930s21c1
Sequence:CCGGACAAATCACTTGAAGTCTAAACTCGAGTTTAGACTTCAAGTGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013835.2-2220s21c1
Sequence:CCGGATGAACCTCACCAGGTAAATTCTCGAGAATTTACCTGGTGAGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013835.1-386s1c1
Sequence:CCGGGCGGACATAAACACAAAGCAACTCGAGTTGCTTTGTGTTTATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013835.1-1325s1c1
Sequence:CCGGGCCTGTGATATGGTTCCGTTTCTCGAGAAACGGAACCATATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013835.1-1655s1c1
Sequence:CCGGGCTCTGGATGTAATTCGGAATCTCGAGATTCCGAATTACATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013835.1-466s1c1
Sequence:CCGGCCAGTTTAAGAAAGACCTGAACTCGAGTTCAGGTCTTTCTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013835.1-1459s1c1
Sequence:CCGGCGCAGATGTCTTCGTTGTGTTCTCGAGAACACAACGAAGACATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013835
VALIDATED
TROVE2 MISSION shRNA Lentiviral Transduction Particles
TROVE domain family, member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-1628s21c1
Sequence:CCGGTCCTGCTAAATTGATTGTTTGCTCGAGCAAACAATCAATTTAGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-1651s21c1
Sequence:CCGGGGATGACATCAAATGGCTTTACTCGAGTAAAGCCATTTGATGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-185s21c1
Sequence:CCGGGAGTGAGACTCAAGTAGTTAACTCGAGTTAACTACTTGAGTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013835.2-930s21c1
Sequence:CCGGACAAATCACTTGAAGTCTAAACTCGAGTTTAGACTTCAAGTGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013835.2-2220s21c1
Sequence:CCGGATGAACCTCACCAGGTAAATTCTCGAGAATTTACCTGGTGAGGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013835.1-386s1c1
Sequence:CCGGGCGGACATAAACACAAAGCAACTCGAGTTGCTTTGTGTTTATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013835.1-1325s1c1
Sequence:CCGGGCCTGTGATATGGTTCCGTTTCTCGAGAAACGGAACCATATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013835.1-1655s1c1
Sequence:CCGGGCTCTGGATGTAATTCGGAATCTCGAGATTCCGAATTACATCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013835.1-466s1c1
Sequence:CCGGCCAGTTTAAGAAAGACCTGAACTCGAGTTCAGGTCTTTCTTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013835.1-1459s1c1
Sequence:CCGGCGCAGATGTCTTCGTTGTGTTCTCGAGAACACAACGAAGACATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004600
VALIDATED
TROVE2 MISSION shRNA Bacterial Glycerol Stock
TROVE domain family, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004600.4-1996s21c1
Sequence:GTACCGGCTGGATGTAATTCGAAATTTCCTCGAGGAAATTTCGAATTACATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004600.4-2659s21c1
Sequence:CCGGGTGGAATATGTTACCATTAATCTCGAGATTAATGGTAACATATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004600.4-1306s21c1
Sequence:CCGGGGAAATTCAGAAGTATCTTTACTCGAGTAAAGATACTTCTGAATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004600.4-1245s21c1
Sequence:CCGGGCCGCTTACTGCATTACTAAGCTCGAGCTTAGTAATGCAGTAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004600.4-947s21c1
Sequence:CCGGGGTCTCACAAAGATCTATTAACTCGAGTTAATAGATCTTTGTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-1659s1c1
Sequence:CCGGCTGAGGGAGTATCGAAAGAAACTCGAGTTTCTTTCGATACTCCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-1320s1c1
Sequence:CCGGCGTTTCTTACTAGCTGTTGATCTCGAGATCAACAGCTAGTAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004600.3-1347s1c1
Sequence:CCGGGCTTCTATGAACCAAAGAGTTCTCGAGAACTCTTTGGTTCATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-1161s1c1
Sequence:CCGGGCTCGTATACATCCATTTCATCTCGAGATGAAATGGATGTATACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-2453s1c1
Sequence:CCGGCGTGGAATATGTTACCATTAACTCGAGTTAATGGTAACATATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004600
VALIDATED
TROVE2 MISSION shRNA shRNA Plasmid DNA
TROVE domain family, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004600.4-1996s21c1
Sequence:GTACCGGCTGGATGTAATTCGAAATTTCCTCGAGGAAATTTCGAATTACATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004600.4-2659s21c1
Sequence:CCGGGTGGAATATGTTACCATTAATCTCGAGATTAATGGTAACATATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004600.4-1306s21c1
Sequence:CCGGGGAAATTCAGAAGTATCTTTACTCGAGTAAAGATACTTCTGAATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004600.4-1245s21c1
Sequence:CCGGGCCGCTTACTGCATTACTAAGCTCGAGCTTAGTAATGCAGTAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004600.4-947s21c1
Sequence:CCGGGGTCTCACAAAGATCTATTAACTCGAGTTAATAGATCTTTGTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-1659s1c1
Sequence:CCGGCTGAGGGAGTATCGAAAGAAACTCGAGTTTCTTTCGATACTCCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-1320s1c1
Sequence:CCGGCGTTTCTTACTAGCTGTTGATCTCGAGATCAACAGCTAGTAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004600.3-1347s1c1
Sequence:CCGGGCTTCTATGAACCAAAGAGTTCTCGAGAACTCTTTGGTTCATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-1161s1c1
Sequence:CCGGGCTCGTATACATCCATTTCATCTCGAGATGAAATGGATGTATACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-2453s1c1
Sequence:CCGGCGTGGAATATGTTACCATTAACTCGAGTTAATGGTAACATATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004600
VALIDATED
TROVE2 MISSION shRNA Lentiviral Transduction Particles
TROVE domain family, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004600.4-1996s21c1
Sequence:GTACCGGCTGGATGTAATTCGAAATTTCCTCGAGGAAATTTCGAATTACATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004600.4-2659s21c1
Sequence:CCGGGTGGAATATGTTACCATTAATCTCGAGATTAATGGTAACATATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004600.4-1306s21c1
Sequence:CCGGGGAAATTCAGAAGTATCTTTACTCGAGTAAAGATACTTCTGAATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004600.4-1245s21c1
Sequence:CCGGGCCGCTTACTGCATTACTAAGCTCGAGCTTAGTAATGCAGTAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004600.4-947s21c1
Sequence:CCGGGGTCTCACAAAGATCTATTAACTCGAGTTAATAGATCTTTGTGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-1659s1c1
Sequence:CCGGCTGAGGGAGTATCGAAAGAAACTCGAGTTTCTTTCGATACTCCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-1320s1c1
Sequence:CCGGCGTTTCTTACTAGCTGTTGATCTCGAGATCAACAGCTAGTAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004600.3-1347s1c1
Sequence:CCGGGCTTCTATGAACCAAAGAGTTCTCGAGAACTCTTTGGTTCATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-1161s1c1
Sequence:CCGGGCTCGTATACATCCATTTCATCTCGAGATGAAATGGATGTATACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_004600.3-2453s1c1
Sequence:CCGGCGTGGAATATGTTACCATTAACTCGAGTTAATGGTAACATATTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks