EMAIL THIS PAGE TO A FRIEND

TRPA1

transient receptor potential cation channel, subfamily A, member 1

Synonyms: ANKTM1 FEPS
UniProtKB ID: O75762, A6NIN6
Gene ID:
Human(8989) Summary: The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined; however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008]
Mouse(277328) transient receptor potential cation channel, subfamily A, member 1
Rat(312896) transient receptor potential cation channel, subfamily A, member 1
fruit fly(39015) Transient receptor potential A1
dog(486994) transient receptor potential cation channel, subfamily A, member 1
domestic cat(101080611) transient receptor potential cation channel, subfamily A, member 1
chicken(420180) transient receptor potential cation channel, subfamily A, member 1
cow(505317) transient receptor potential cation channel, subfamily A, member 1
sheep(101115717) transient receptor potential cation channel, subfamily A, member 1
naked mole-rat(101723077) transient receptor potential cation channel, subfamily A, member 1
domestic guinea pig(100526649) transient receptor potential cation channel, subfamily A, member 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007332 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007332 Rosetta Predictions human pricing
NM_207608 Rosetta Predictions rat pricing
NM_177781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062979 predicted 1168
2 SASI_Hs01_00062980 predicted 3009
3 SASI_Hs01_00062981 predicted 1528
4 SASI_Hs02_00343412 predicted 2268
5 SASI_Hs02_00343413 predicted 1659
6 SASI_Hs02_00343414 predicted 1253
7 SASI_Hs01_00062983 predicted 3136
8 SASI_Hs02_00343415 predicted 2675
9 SASI_Hs01_00062984 predicted 2457
10 SASI_Hs01_00062985 predicted 2310
11 SASI_Hs01_00062978 predicted 264
12 SASI_Hs01_00062982 predicted 2252
13 SASI_Hs01_00062986 predicted 1060
14 SASI_Hs01_00062987 predicted 2936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270435 predicted 269
2 SASI_Rn02_00270436 predicted 2049
3 SASI_Rn01_00065270 predicted 1071
4 SASI_Rn01_00065271 predicted 1959
5 SASI_Rn01_00065273 predicted 2500
6 SASI_Rn01_00065275 predicted 1600
7 SASI_Rn01_00065276 predicted 2030
8 SASI_Rn01_00065277 predicted 642
9 SASI_Rn01_00065278 predicted 2254
10 SASI_Rn01_00065279 predicted 1082
11 SASI_Rn01_00065272 predicted 2622
12 SASI_Rn01_00065274 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151731 predicted 2059
2 SASI_Mm01_00151732 predicted 1382
3 SASI_Mm01_00151734 predicted 2850
4 SASI_Mm01_00151735 predicted 2072
5 SASI_Mm01_00151736 predicted 2640
6 SASI_Mm02_00348196 predicted 2082
7 SASI_Mm01_00151737 predicted 1781
8 SASI_Mm01_00151738 predicted 906
9 SASI_Mm01_00151739 predicted 670
10 SASI_Mm02_00348197 predicted 1628
11 SASI_Mm01_00151733 predicted 1108
12 SASI_Mm01_00151740 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007332
TRPA1 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily A, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007332.2-3947s21c1
Sequence:CCGGTGCCTTAGATGATAGTCTTAACTCGAGTTAAGACTATCATCTAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007332.2-2333s21c1
Sequence:CCGGATGATGAATTTAGGATCTTACCTCGAGGTAAGATCCTAAATTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007332.2-1139s21c1
Sequence:CCGGCATGAGCTAGCAGACTATTTACTCGAGTAAATAGTCTGCTAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-2023s1c1
Sequence:CCGGCCAGGCAATAAATGTCCAATTCTCGAGAATTGGACATTTATTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-2128s1c1
Sequence:CCGGCGAGACTATTATATCGAGTATCTCGAGATACTCGATATAATAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-549s1c1
Sequence:CCGGCCTCCGAAACTTCAACATGATCTCGAGATCATGTTGAAGTTTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-695s1c1
Sequence:CCGGCCACAAATAATAGCGAAGCATCTCGAGATGCTTCGCTATTATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-2585s1c1
Sequence:CCGGGCAATGTTCTTGAATGGATTACTCGAGTAATCCATTCAAGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007332
TRPA1 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily A, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007332.2-3947s21c1
Sequence:CCGGTGCCTTAGATGATAGTCTTAACTCGAGTTAAGACTATCATCTAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007332.2-2333s21c1
Sequence:CCGGATGATGAATTTAGGATCTTACCTCGAGGTAAGATCCTAAATTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007332.2-1139s21c1
Sequence:CCGGCATGAGCTAGCAGACTATTTACTCGAGTAAATAGTCTGCTAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-2023s1c1
Sequence:CCGGCCAGGCAATAAATGTCCAATTCTCGAGAATTGGACATTTATTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-2128s1c1
Sequence:CCGGCGAGACTATTATATCGAGTATCTCGAGATACTCGATATAATAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-549s1c1
Sequence:CCGGCCTCCGAAACTTCAACATGATCTCGAGATCATGTTGAAGTTTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-695s1c1
Sequence:CCGGCCACAAATAATAGCGAAGCATCTCGAGATGCTTCGCTATTATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-2585s1c1
Sequence:CCGGGCAATGTTCTTGAATGGATTACTCGAGTAATCCATTCAAGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007332
TRPA1 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily A, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007332.2-3947s21c1
Sequence:CCGGTGCCTTAGATGATAGTCTTAACTCGAGTTAAGACTATCATCTAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007332.2-2333s21c1
Sequence:CCGGATGATGAATTTAGGATCTTACCTCGAGGTAAGATCCTAAATTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007332.2-1139s21c1
Sequence:CCGGCATGAGCTAGCAGACTATTTACTCGAGTAAATAGTCTGCTAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-2023s1c1
Sequence:CCGGCCAGGCAATAAATGTCCAATTCTCGAGAATTGGACATTTATTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-2128s1c1
Sequence:CCGGCGAGACTATTATATCGAGTATCTCGAGATACTCGATATAATAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-549s1c1
Sequence:CCGGCCTCCGAAACTTCAACATGATCTCGAGATCATGTTGAAGTTTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-695s1c1
Sequence:CCGGCCACAAATAATAGCGAAGCATCTCGAGATGCTTCGCTATTATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007332.1-2585s1c1
Sequence:CCGGGCAATGTTCTTGAATGGATTACTCGAGTAATCCATTCAAGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177781
TRPA1 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily A, member 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000174790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-596s1c1
Sequence:CCGGGCTAAGCTGTGTAAATCAAATCTCGAGATTTGATTTACACAGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-1806s1c1
Sequence:CCGGGCAAGGAAGTGGTTCTCACAACTCGAGTTGTGAGAACCACTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-301s1c1
Sequence:CCGGGCTGAATATAATGGATGGTTACTCGAGTAACCATCCATTATATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-406s1c1
Sequence:CCGGCCTCCGAAATAGAAACATGATCTCGAGATCATGTTTCTATTTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177781
TRPA1 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily A, member 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000174790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-596s1c1
Sequence:CCGGGCTAAGCTGTGTAAATCAAATCTCGAGATTTGATTTACACAGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-1806s1c1
Sequence:CCGGGCAAGGAAGTGGTTCTCACAACTCGAGTTGTGAGAACCACTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-301s1c1
Sequence:CCGGGCTGAATATAATGGATGGTTACTCGAGTAACCATCCATTATATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-406s1c1
Sequence:CCGGCCTCCGAAATAGAAACATGATCTCGAGATCATGTTTCTATTTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177781
TRPA1 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily A, member 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000174790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-596s1c1
Sequence:CCGGGCTAAGCTGTGTAAATCAAATCTCGAGATTTGATTTACACAGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-1806s1c1
Sequence:CCGGGCAAGGAAGTGGTTCTCACAACTCGAGTTGTGAGAACCACTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-301s1c1
Sequence:CCGGGCTGAATATAATGGATGGTTACTCGAGTAACCATCCATTATATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177781.2-406s1c1
Sequence:CCGGCCTCCGAAATAGAAACATGATCTCGAGATCATGTTTCTATTTCGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks