EMAIL THIS PAGE TO A FRIEND

TRPC1

transient receptor potential cation channel, subfamily C, member 1

Synonyms: HTRP-1 TRP1
UniProtKB ID: P48995, Q14CE4
Gene ID:
Human(7220) Summary: The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(22063) transient receptor potential cation channel, subfamily C, member 1
Rat(89821) transient receptor potential cation channel, subfamily C, member 1
Zebrafish(570841) transient receptor potential cation channel, subfamily C, member 1
Horse(100062355) transient receptor potential cation channel, subfamily C, member 1
domestic cat(101096835) transient receptor potential cation channel, subfamily C, member 1
dog(485698) transient receptor potential cation channel, subfamily C, member 1
chicken(424776) transient receptor potential cation channel, subfamily C, member 1
domestic guinea pig(100713312) transient receptor potential cation channel, subfamily C, member 1
naked mole-rat(101696653) transient receptor potential cation channel, subfamily C, member 1
cow(282100) transient receptor potential cation channel, subfamily C, member 1
sheep(101105204) transient receptor potential cation channel, subfamily C, member 1
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003304 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003304 Rosetta Predictions human pricing
NM_053558 Rosetta Predictions rat pricing
NM_011643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060664 predicted 2085
2 SASI_Hs02_00335399 predicted 1912
3 SASI_Hs02_00335400 predicted 503
4 SASI_Hs01_00060665 predicted 1453
5 SASI_Hs02_00335401 predicted 535
6 SASI_Hs01_00060667 predicted 1843
7 SASI_Hs01_00060668 predicted 2092
8 SASI_Hs01_00060669 predicted 2416
9 SASI_Hs02_00335402 predicted 455
10 SASI_Hs01_00060671 predicted 1289
11 SASI_Hs01_00060666 predicted 1172
12 SASI_Hs01_00060670 predicted 701
13 SASI_Hs01_00060672 predicted 1356
14 SASI_Hs01_00060673 predicted 1596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266215 predicted 1211
2 SASI_Rn01_00120295 predicted 2241
3 SASI_Rn01_00120297 predicted 1343
4 SASI_Rn01_00120298 predicted 873
5 SASI_Rn01_00120299 predicted 1534
6 SASI_Rn01_00120300 predicted 581
7 SASI_Rn01_00120301 predicted 1050
8 SASI_Rn01_00120302 predicted 672
9 SASI_Rn01_00120303 predicted 722
10 SASI_Rn02_00266216 predicted 532
11 SASI_Rn01_00120296 predicted 765
12 SASI_Rn01_00120304 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090302 predicted 1812
2 SASI_Mm01_00090303 predicted 1424
3 SASI_Mm02_00321112 predicted 2401
4 SASI_Mm01_00090306 predicted 2506
5 SASI_Mm01_00090307 predicted 2524
6 SASI_Mm01_00090308 predicted 1323
7 SASI_Mm01_00090309 predicted 1631
8 SASI_Mm01_00090310 predicted 1688
9 SASI_Mm01_00090311 predicted 2493
10 SASI_Mm02_00321113 predicted 1191
11 SASI_Mm01_00090304 predicted 1651
12 SASI_Mm01_00090305 predicted 1474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011643
VALIDATED
TRPC1 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-2832s1c1
Sequence:CCGGCCGAAATGAAATAAGGGATTTCTCGAGAAATCCCTTATTTCATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-2332s1c1
Sequence:CCGGGCCATCTTTGTCACCAGGTTTCTCGAGAAACCTGGTGACAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-1619s1c1
Sequence:CCGGGCTATTTGATAGCTCCCAAATCTCGAGATTTGGGAGCTATCAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011643.1-1324s1c1
Sequence:CCGGGCTAAAGATTTGCTCGCACAACTCGAGTTGTGCGAGCAAATCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-1488s1c1
Sequence:CCGGCCAGTCAAATTGCCAGCAGTTCTCGAGAACTGCTGGCAATTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-1684s21c1
Sequence:CCGGATTCATGGAGCATCGTATTTCCTCGAGGAAATACGATGCTCCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-682s21c1
Sequence:CCGGTGCGACAAGGGTGACTATTATCTCGAGATAATAGTCACCCTTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-1151s21c1
Sequence:CCGGGGTTTCGTCTTGATATCTATACTCGAGTATAGATATCAAGACGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-1324s21c1
Sequence:CCGGGCTAAAGATTTGCTCGCACAACTCGAGTTGTGCGAGCAAATCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011643.2-891s21c1
Sequence:CCGGAGCTGTTGATATACTACTTAACTCGAGTTAAGTAGTATATCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011643
VALIDATED
TRPC1 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-2832s1c1
Sequence:CCGGCCGAAATGAAATAAGGGATTTCTCGAGAAATCCCTTATTTCATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-2332s1c1
Sequence:CCGGGCCATCTTTGTCACCAGGTTTCTCGAGAAACCTGGTGACAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-1619s1c1
Sequence:CCGGGCTATTTGATAGCTCCCAAATCTCGAGATTTGGGAGCTATCAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011643.1-1324s1c1
Sequence:CCGGGCTAAAGATTTGCTCGCACAACTCGAGTTGTGCGAGCAAATCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-1488s1c1
Sequence:CCGGCCAGTCAAATTGCCAGCAGTTCTCGAGAACTGCTGGCAATTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-1684s21c1
Sequence:CCGGATTCATGGAGCATCGTATTTCCTCGAGGAAATACGATGCTCCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-682s21c1
Sequence:CCGGTGCGACAAGGGTGACTATTATCTCGAGATAATAGTCACCCTTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-1151s21c1
Sequence:CCGGGGTTTCGTCTTGATATCTATACTCGAGTATAGATATCAAGACGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-1324s21c1
Sequence:CCGGGCTAAAGATTTGCTCGCACAACTCGAGTTGTGCGAGCAAATCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011643.2-891s21c1
Sequence:CCGGAGCTGTTGATATACTACTTAACTCGAGTTAAGTAGTATATCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011643
VALIDATED
TRPC1 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-2832s1c1
Sequence:CCGGCCGAAATGAAATAAGGGATTTCTCGAGAAATCCCTTATTTCATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-2332s1c1
Sequence:CCGGGCCATCTTTGTCACCAGGTTTCTCGAGAAACCTGGTGACAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-1619s1c1
Sequence:CCGGGCTATTTGATAGCTCCCAAATCTCGAGATTTGGGAGCTATCAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011643.1-1324s1c1
Sequence:CCGGGCTAAAGATTTGCTCGCACAACTCGAGTTGTGCGAGCAAATCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011643.1-1488s1c1
Sequence:CCGGCCAGTCAAATTGCCAGCAGTTCTCGAGAACTGCTGGCAATTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-1684s21c1
Sequence:CCGGATTCATGGAGCATCGTATTTCCTCGAGGAAATACGATGCTCCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-682s21c1
Sequence:CCGGTGCGACAAGGGTGACTATTATCTCGAGATAATAGTCACCCTTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-1151s21c1
Sequence:CCGGGGTTTCGTCTTGATATCTATACTCGAGTATAGATATCAAGACGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011643.2-1324s21c1
Sequence:CCGGGCTAAAGATTTGCTCGCACAACTCGAGTTGTGCGAGCAAATCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011643.2-891s21c1
Sequence:CCGGAGCTGTTGATATACTACTTAACTCGAGTTAAGTAGTATATCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003304
VALIDATED
TRPC1 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003304.3-1070s1c1
Sequence:CCGGGCCCACCTGTAAGAAGATAATCTCGAGATTATCTTCTTACAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003304.3-840s1c1
Sequence:CCGGGCTAAGGATTTACTTGCACAACTCGAGTTGTGCAAGTAAATCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003304.3-534s1c1
Sequence:CCGGGCTCATCGTAACAACTATGAACTCGAGTTCATAGTTGTTACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003304.3-2044s1c1
Sequence:CCGGGCTACTTTGATGACAAATGTACTCGAGTACATTTGTCATCAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003304.4-1069s21c1
Sequence:CCGGGCCCACCTGTAAGAAGATAATCTCGAGATTATCTTCTTACAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003304.4-839s21c1
Sequence:CCGGGCTAAGGATTTACTTGCACAACTCGAGTTGTGCAAGTAAATCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003304.4-299s21c1
Sequence:CCGGTGCGACAAGGGTGACTATTATCTCGAGATAATAGTCACCCTTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003304.4-2424s21c1
Sequence:CCGGCTAAATCATGGAGCGAATAATCTCGAGATTATTCGCTCCATGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003304
VALIDATED
TRPC1 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003304.3-1070s1c1
Sequence:CCGGGCCCACCTGTAAGAAGATAATCTCGAGATTATCTTCTTACAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003304.3-840s1c1
Sequence:CCGGGCTAAGGATTTACTTGCACAACTCGAGTTGTGCAAGTAAATCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003304.3-534s1c1
Sequence:CCGGGCTCATCGTAACAACTATGAACTCGAGTTCATAGTTGTTACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003304.3-2044s1c1
Sequence:CCGGGCTACTTTGATGACAAATGTACTCGAGTACATTTGTCATCAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003304.4-1069s21c1
Sequence:CCGGGCCCACCTGTAAGAAGATAATCTCGAGATTATCTTCTTACAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003304.4-839s21c1
Sequence:CCGGGCTAAGGATTTACTTGCACAACTCGAGTTGTGCAAGTAAATCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003304.4-299s21c1
Sequence:CCGGTGCGACAAGGGTGACTATTATCTCGAGATAATAGTCACCCTTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003304.4-2424s21c1
Sequence:CCGGCTAAATCATGGAGCGAATAATCTCGAGATTATTCGCTCCATGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003304
VALIDATED
TRPC1 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003304.3-1070s1c1
Sequence:CCGGGCCCACCTGTAAGAAGATAATCTCGAGATTATCTTCTTACAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003304.3-840s1c1
Sequence:CCGGGCTAAGGATTTACTTGCACAACTCGAGTTGTGCAAGTAAATCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003304.3-534s1c1
Sequence:CCGGGCTCATCGTAACAACTATGAACTCGAGTTCATAGTTGTTACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003304.3-2044s1c1
Sequence:CCGGGCTACTTTGATGACAAATGTACTCGAGTACATTTGTCATCAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003304.4-1069s21c1
Sequence:CCGGGCCCACCTGTAAGAAGATAATCTCGAGATTATCTTCTTACAGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003304.4-839s21c1
Sequence:CCGGGCTAAGGATTTACTTGCACAACTCGAGTTGTGCAAGTAAATCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003304.4-299s21c1
Sequence:CCGGTGCGACAAGGGTGACTATTATCTCGAGATAATAGTCACCCTTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003304.4-2424s21c1
Sequence:CCGGCTAAATCATGGAGCGAATAATCTCGAGATTATTCGCTCCATGATTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks