EMAIL THIS PAGE TO A FRIEND

TRPC2

transient receptor potential cation channel, subfamily C, member 2, pseudogene

Gene ID:
Mouse(22064) transient receptor potential cation channel, subfamily C, member 2
Rat(64573) transient receptor potential cation channel, subfamily C, member 2, pseudogene
Domestic Rabbit(100009370) transient receptor potential protein 2
cow(282101) transient receptor potential channel 2
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002720 Rosetta Predictions human pricing
NM_022638 Rosetta Predictions rat pricing
NM_001109897 Rosetta Predictions mouse pricing
NM_011644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376383 predicted 295
2 SASI_Hs02_00376384 predicted 595
3 SASI_Hs02_00376385 predicted 281
4 SASI_Hs02_00376386 predicted 335
5 SASI_Hs02_00376387 predicted 523
6 SASI_Hs02_00376388 predicted 264
7 SASI_Hs02_00376389 predicted 258
8 SASI_Hs02_00376390 predicted 332
9 SASI_Hs02_00376391 predicted 482
10 SASI_Hs02_00376392 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044888 predicted 1622
2 SASI_Rn01_00044889 predicted 1333
3 SASI_Rn01_00044890 predicted 1310
4 SASI_Rn01_00044891 predicted 2547
5 SASI_Rn01_00044892 predicted 633
6 SASI_Rn01_00044893 predicted 1318
7 SASI_Rn01_00044894 predicted 2315
8 SASI_Rn01_00044895 predicted 1902
9 SASI_Rn01_00044896 predicted 771
10 SASI_Rn01_00044897 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304374 predicted 297
2 SASI_Mm02_00304375 predicted 1626
3 SASI_Mm02_00304376 predicted 639
4 SASI_Mm02_00304377 predicted 1322
5 SASI_Mm02_00304378 predicted 455
6 SASI_Mm02_00304379 predicted 1907
7 SASI_Mm02_00304380 predicted 779
8 SASI_Mm02_00304381 predicted 1833
9 SASI_Mm02_00304382 predicted 1518
10 SASI_Mm02_00304383 predicted 1925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321114 predicted 1551
2 SASI_Mm01_00143555 predicted 2883
3 SASI_Mm01_00143556 predicted 1898
4 SASI_Mm01_00143557 predicted 2578
5 SASI_Mm01_00143558 predicted 1712
6 SASI_Mm01_00143559 predicted 3162
7 SASI_Mm01_00143560 predicted 2038
8 SASI_Mm02_00321115 predicted 3083
9 SASI_Mm02_00321116 predicted 2780
10 SASI_Mm01_00143563 predicted 3188
11 SASI_Mm01_00143554 predicted 703
12 SASI_Mm01_00143561 predicted 702
13 SASI_Mm01_00143562 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011644
TRPC2 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 2, pseudogene
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-1255s1c1
Sequence:CCGGGCCTTCTTTGACTCATCGATTCTCGAGAATCGATGAGTCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-2709s1c1
Sequence:CCGGCGGCATCTTTACCATCGTCATCTCGAGATGACGATGGTAAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-1575s1c1
Sequence:CCGGGCCTGAGTTTAAGCCTCAGTACTCGAGTACTGAGGCTTAAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-287s1c1
Sequence:CCGGCCTGGCTGACTAATCCTTCTACTCGAGTAGAAGGATTAGTCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-1111s1c1
Sequence:CCGGGCCAATGTCAAATTCGACTTTCTCGAGAAAGTCGAATTTGACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011644
TRPC2 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 2, pseudogene
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-1255s1c1
Sequence:CCGGGCCTTCTTTGACTCATCGATTCTCGAGAATCGATGAGTCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-2709s1c1
Sequence:CCGGCGGCATCTTTACCATCGTCATCTCGAGATGACGATGGTAAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-1575s1c1
Sequence:CCGGGCCTGAGTTTAAGCCTCAGTACTCGAGTACTGAGGCTTAAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-287s1c1
Sequence:CCGGCCTGGCTGACTAATCCTTCTACTCGAGTAGAAGGATTAGTCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-1111s1c1
Sequence:CCGGGCCAATGTCAAATTCGACTTTCTCGAGAAAGTCGAATTTGACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011644
TRPC2 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 2, pseudogene
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-1255s1c1
Sequence:CCGGGCCTTCTTTGACTCATCGATTCTCGAGAATCGATGAGTCAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-2709s1c1
Sequence:CCGGCGGCATCTTTACCATCGTCATCTCGAGATGACGATGGTAAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-1575s1c1
Sequence:CCGGGCCTGAGTTTAAGCCTCAGTACTCGAGTACTGAGGCTTAAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-287s1c1
Sequence:CCGGCCTGGCTGACTAATCCTTCTACTCGAGTAGAAGGATTAGTCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011644.1-1111s1c1
Sequence:CCGGGCCAATGTCAAATTCGACTTTCTCGAGAAAGTCGAATTTGACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks