EMAIL THIS PAGE TO A FRIEND

TRPC3

transient receptor potential cation channel, subfamily C, member 3

Synonyms: TRP3
Gene ID:
Human(7222) Summary: The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(22065) transient receptor potential cation channel, subfamily C, member 3
Rat(60395) transient receptor potential cation channel, subfamily C, member 3
Zebrafish(100330228) transient receptor potential cation channel, subfamily C, member 3
chicken(374153) transient receptor potential cation channel, subfamily C, member 3
domestic cat(101087919) transient receptor potential cation channel, subfamily C, member 3
Horse(100072204) transient receptor potential cation channel, subfamily C, member 3
dog(483844) transient receptor potential cation channel, subfamily C, member 3
cow(286866) transient receptor potential cation channel, subfamily C, member 3
Goat(100860931) transient receptor potential cation channel, subfamily C, member 3
sheep(101105027) transient receptor potential cation channel, subfamily C, member 3
domestic guinea pig(100135636) transient receptor potential cation channel, subfamily C, member 3
Domestic Rabbit(100343668) transient receptor potential cation channel, subfamily C, member 3
naked mole-rat(101719053) transient receptor potential cation channel, subfamily C, member 3
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003305 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003305 Rosetta Predictions human pricing
NM_021771 Rosetta Predictions rat pricing
NM_019510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195103 predicted 2720
2 SASI_Hs01_00195104 predicted 2355
3 SASI_Hs01_00195105 predicted 1972
4 SASI_Hs01_00195106 predicted 1718
5 SASI_Hs01_00195107 predicted 2389
6 SASI_Hs01_00195109 predicted 2736
7 SASI_Hs01_00195110 predicted 2287
8 SASI_Hs01_00195111 predicted 2040
9 SASI_Hs01_00195112 predicted 1341
10 SASI_Hs02_00335403 predicted 1903
11 SASI_Hs01_00195108 predicted 2817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072668 predicted 677
2 SASI_Rn01_00072669 predicted 984
3 SASI_Rn01_00072670 predicted 1402
4 SASI_Rn01_00072671 predicted 2045
5 SASI_Rn01_00072672 predicted 1229
6 SASI_Rn01_00072673 predicted 1678
7 SASI_Rn01_00072674 predicted 1303
8 SASI_Rn01_00072675 predicted 1614
9 SASI_Rn01_00072676 predicted 1017
10 SASI_Rn01_00072677 predicted 1984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086548 predicted 2339
2 SASI_Mm01_00086549 predicted 2672
3 SASI_Mm01_00086551 predicted 2684
4 SASI_Mm01_00086552 predicted 2973
5 SASI_Mm01_00086553 predicted 2608
6 SASI_Mm01_00086554 predicted 2928
7 SASI_Mm02_00324546 predicted 1927
8 SASI_Mm01_00086555 predicted 2235
9 SASI_Mm01_00086556 predicted 2304
10 SASI_Mm01_00086557 predicted 1677
11 SASI_Mm01_00086550 predicted 2549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019510
TRPC3 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019510.1-2612s1c1
Sequence:CCGGCCCTACCTTTATCATGCGAAACTCGAGTTTCGCATGATAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-591s1c1
Sequence:CCGGCCACTCAAGGTCTAGGATCAACTCGAGTTGATCCTAGACCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-1061s1c1
Sequence:CCGGGCTATTGGATTGCACCTTGTACTCGAGTACAAGGTGCAATCCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-1203s1c1
Sequence:CCGGGCTGCCAAACATCACTGTTATCTCGAGATAACAGTGATGTTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-1904s1c1
Sequence:CCGGGCTATGTTCTTTATGGGATATCTCGAGATATCCCATAAAGAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019510.2-2802s21c1
Sequence:CCGGGATATCTCCAGCCTTCGTTATCTCGAGATAACGAAGGCTGGAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019510.2-2679s21c1
Sequence:CCGGCTCAATCAGCCAACACGATATCTCGAGATATCGTGTTGGCTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019510.2-1295s21c1
Sequence:CCGGTCGTGTCAAACTTGCCATTAACTCGAGTTAATGGCAAGTTTGACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019510
TRPC3 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019510.1-2612s1c1
Sequence:CCGGCCCTACCTTTATCATGCGAAACTCGAGTTTCGCATGATAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-591s1c1
Sequence:CCGGCCACTCAAGGTCTAGGATCAACTCGAGTTGATCCTAGACCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-1061s1c1
Sequence:CCGGGCTATTGGATTGCACCTTGTACTCGAGTACAAGGTGCAATCCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-1203s1c1
Sequence:CCGGGCTGCCAAACATCACTGTTATCTCGAGATAACAGTGATGTTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-1904s1c1
Sequence:CCGGGCTATGTTCTTTATGGGATATCTCGAGATATCCCATAAAGAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019510.2-2802s21c1
Sequence:CCGGGATATCTCCAGCCTTCGTTATCTCGAGATAACGAAGGCTGGAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019510.2-2679s21c1
Sequence:CCGGCTCAATCAGCCAACACGATATCTCGAGATATCGTGTTGGCTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019510.2-1295s21c1
Sequence:CCGGTCGTGTCAAACTTGCCATTAACTCGAGTTAATGGCAAGTTTGACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019510
TRPC3 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019510.1-2612s1c1
Sequence:CCGGCCCTACCTTTATCATGCGAAACTCGAGTTTCGCATGATAAAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-591s1c1
Sequence:CCGGCCACTCAAGGTCTAGGATCAACTCGAGTTGATCCTAGACCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-1061s1c1
Sequence:CCGGGCTATTGGATTGCACCTTGTACTCGAGTACAAGGTGCAATCCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-1203s1c1
Sequence:CCGGGCTGCCAAACATCACTGTTATCTCGAGATAACAGTGATGTTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019510.1-1904s1c1
Sequence:CCGGGCTATGTTCTTTATGGGATATCTCGAGATATCCCATAAAGAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019510.2-2802s21c1
Sequence:CCGGGATATCTCCAGCCTTCGTTATCTCGAGATAACGAAGGCTGGAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019510.2-2679s21c1
Sequence:CCGGCTCAATCAGCCAACACGATATCTCGAGATATCGTGTTGGCTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019510.2-1295s21c1
Sequence:CCGGTCGTGTCAAACTTGCCATTAACTCGAGTTAATGGCAAGTTTGACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003305
TRPC3 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1719s1c1
Sequence:CCGGCCCAGTTTACATGGACTGAAACTCGAGTTTCAGTCCATGTAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1662s1c1
Sequence:CCGGCGCTGCCCAATATCACAGTTACTCGAGTAACTGTGATATTGGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1334s1c1
Sequence:CCGGGCTTCATTAAGTCGTGTCAAACTCGAGTTTGACACGACTTAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1969s1c1
Sequence:CCGGCCCACCAGAGATACAGTATTTCTCGAGAAATACTGTATCTCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-2859s1c1
Sequence:CCGGCCAGCCTTCGTTATGAACTTTCTCGAGAAAGTTCATAACGAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003305.2-2380s21c1
Sequence:CCGGCTCAATCAGCCAACACGTTATCTCGAGATAACGTGTTGGCTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003305.2-2017s21c1
Sequence:CCGGTACGTTCTTTATGGAATATACCTCGAGGTATATTCCATAAAGAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003305.2-2728s21c1
Sequence:CCGGCCTTTATCATGTGAACCTTTACTCGAGTAAAGGTTCACATGATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003305.2-1969s21c1
Sequence:CCGGACTTCCGTTGTGCTCAAATATCTCGAGATATTTGAGCACAACGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003305
TRPC3 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1719s1c1
Sequence:CCGGCCCAGTTTACATGGACTGAAACTCGAGTTTCAGTCCATGTAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1662s1c1
Sequence:CCGGCGCTGCCCAATATCACAGTTACTCGAGTAACTGTGATATTGGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1334s1c1
Sequence:CCGGGCTTCATTAAGTCGTGTCAAACTCGAGTTTGACACGACTTAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1969s1c1
Sequence:CCGGCCCACCAGAGATACAGTATTTCTCGAGAAATACTGTATCTCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-2859s1c1
Sequence:CCGGCCAGCCTTCGTTATGAACTTTCTCGAGAAAGTTCATAACGAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003305.2-2380s21c1
Sequence:CCGGCTCAATCAGCCAACACGTTATCTCGAGATAACGTGTTGGCTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003305.2-2017s21c1
Sequence:CCGGTACGTTCTTTATGGAATATACCTCGAGGTATATTCCATAAAGAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003305.2-2728s21c1
Sequence:CCGGCCTTTATCATGTGAACCTTTACTCGAGTAAAGGTTCACATGATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003305.2-1969s21c1
Sequence:CCGGACTTCCGTTGTGCTCAAATATCTCGAGATATTTGAGCACAACGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003305
TRPC3 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1719s1c1
Sequence:CCGGCCCAGTTTACATGGACTGAAACTCGAGTTTCAGTCCATGTAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1662s1c1
Sequence:CCGGCGCTGCCCAATATCACAGTTACTCGAGTAACTGTGATATTGGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1334s1c1
Sequence:CCGGGCTTCATTAAGTCGTGTCAAACTCGAGTTTGACACGACTTAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-1969s1c1
Sequence:CCGGCCCACCAGAGATACAGTATTTCTCGAGAAATACTGTATCTCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003305.1-2859s1c1
Sequence:CCGGCCAGCCTTCGTTATGAACTTTCTCGAGAAAGTTCATAACGAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003305.2-2380s21c1
Sequence:CCGGCTCAATCAGCCAACACGTTATCTCGAGATAACGTGTTGGCTGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003305.2-2017s21c1
Sequence:CCGGTACGTTCTTTATGGAATATACCTCGAGGTATATTCCATAAAGAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003305.2-2728s21c1
Sequence:CCGGCCTTTATCATGTGAACCTTTACTCGAGTAAAGGTTCACATGATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003305.2-1969s21c1
Sequence:CCGGACTTCCGTTGTGCTCAAATATCTCGAGATATTTGAGCACAACGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks