EMAIL THIS PAGE TO A FRIEND

TRPC4

transient receptor potential cation channel, subfamily C, member 4

Synonyms: HTRP-4 HTRP4 TRP4
Gene ID:
Human(7223) Summary: This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Mouse(22066) transient receptor potential cation channel, subfamily C, member 4
Rat(84494) transient receptor potential cation channel, subfamily C, member 4
naked mole-rat(101712632) transient receptor potential cation channel, subfamily C, member 4
Domestic Rabbit(100353818) transient receptor potential cation channel, subfamily C, member 4
domestic guinea pig(100233224) transient receptor potential cation channel, subfamily C, member 4
cow(282102) transient receptor potential cation channel, subfamily C, member 4
sheep(101102401) transient receptor potential cation channel, subfamily C, member 4
Zebrafish(566436) transient receptor potential cation channel, subfamily C, member 4
Horse(100062641) transient receptor potential cation channel, subfamily C, member 4
domestic cat(101087035) transient receptor potential cation channel, subfamily C, member 4
dog(486004) transient receptor potential cation channel, subfamily C, member 4
chicken(418895) transient receptor potential cation channel, subfamily C, member 4
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501064 Anti-TRPC4 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, bovine, rat, human
ELISA, western blot pricing
SAB2108245 Anti-TRPC4 antibody produced in rabbit affinity isolated antibody canine, mouse, rabbit, guinea pig, human, bovine, horse, pig, rat
immunohistochemistry, western blot pricing
SAB2102582 Anti-TRPC4 antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, rat, human, bovine, mouse, horse, rabbit, pig
western blot pricing
T2568 Anti-TRPC4 antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse (predicted to detect), rat
western blot pricing
SAB5200031 Monoclonal Anti-TRPC4 antibody produced in mouse clone S77-15, 1 mg/mL, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016179 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016179 Rosetta Predictions human pricing
NM_001083115 Rosetta Predictions rat pricing
NM_053434 Rosetta Predictions rat pricing
NM_080396 Rosetta Predictions rat pricing
NM_016984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129366 predicted 2140
2 SASI_Hs01_00129367 predicted 2499
3 SASI_Hs02_00348996 predicted 861
4 SASI_Hs01_00129368 predicted 653
5 SASI_Hs01_00129369 predicted 1511
6 SASI_Hs01_00129370 predicted 2813
7 SASI_Hs01_00129371 predicted 2092
8 SASI_Hs01_00129372 predicted 351
9 SASI_Hs01_00129374 predicted 2371
10 SASI_Hs02_00348997 predicted 3090
11 SASI_Hs01_00129373 predicted 1866
12 SASI_Hs01_00129375 predicted 2451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208829 predicted 291
2 SASI_Rn02_00208830 predicted 1548
3 SASI_Rn02_00208831 predicted 690
4 SASI_Rn02_00208832 predicted 977
5 SASI_Rn02_00208833 predicted 1196
6 SASI_Rn02_00208834 predicted 2130
7 SASI_Rn02_00208835 predicted 1920
8 SASI_Rn02_00208836 predicted 995
9 SASI_Rn02_00208837 predicted 1348
10 SASI_Rn02_00208838 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053434 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058540 predicted 810
2 SASI_Rn01_00058541 predicted 961
3 SASI_Rn01_00058542 predicted 121
4 SASI_Rn01_00058543 predicted 374
5 SASI_Rn01_00058544 predicted 988
6 SASI_Rn01_00058545 predicted 216
7 SASI_Rn01_00058546 predicted 840
8 SASI_Rn01_00058547 predicted 194
9 SASI_Rn01_00058548 predicted 543
10 SASI_Rn01_00058549 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267216 predicted 294
2 SASI_Rn01_00092575 predicted 1547
3 SASI_Rn01_00092576 predicted 691
4 SASI_Rn02_00267217 predicted 978
5 SASI_Rn02_00267218 predicted 1189
6 SASI_Rn01_00092578 predicted 2131
7 SASI_Rn02_00267219 predicted 1921
8 SASI_Rn02_00267220 predicted 995
9 SASI_Rn02_00267221 predicted 1345
10 SASI_Rn02_00267222 predicted 721
11 SASI_Rn01_00092577 predicted 2693
12 SASI_Rn01_00092579 predicted 2060
13 SASI_Rn01_00092580 predicted 2440
14 SASI_Rn01_00092581 predicted 2129
15 SASI_Rn01_00092582 predicted 2587
16 SASI_Rn01_00092583 predicted 2753
17 SASI_Rn01_00092584 predicted 2105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037832 predicted 629
2 SASI_Mm01_00037833 predicted 426
3 SASI_Mm01_00037834 predicted 1618
4 SASI_Mm01_00037836 predicted 1782
5 SASI_Mm02_00323839 predicted 1165
6 SASI_Mm01_00037839 predicted 3178
7 SASI_Mm01_00037840 predicted 896
8 SASI_Mm01_00037841 predicted 750
9 SASI_Mm02_00323840 predicted 1534
10 SASI_Mm02_00323841 predicted 1475
11 SASI_Mm01_00037835 predicted 1165
12 SASI_Mm01_00037837 predicted 1993
13 SASI_Mm01_00037838 predicted 1177
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016179
TRPC4 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016179.2-3189s21c1
Sequence:CCGGTTACCATACACATACGTATTTCTCGAGAAATACGTATGTGTATGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-612s1c1
Sequence:CCGGGCCTCCTATACTCCTTGATAACTCGAGTTATCAAGGAGTATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-1045s1c1
Sequence:CCGGCGAGATGACAATAGTCTCATACTCGAGTATGAGACTATTGTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-1877s1c1
Sequence:CCGGGCAAAGGCATAAGATGTGAAACTCGAGTTTCACATCTTATGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-281s1c1
Sequence:CCGGGCATCCCTCTAAGGATAGTAACTCGAGTTACTATCCTTAGAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-2580s1c1
Sequence:CCGGCGAAGGTAATAGCAAGGACAACTCGAGTTGTCCTTGCTATTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016179
TRPC4 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016179.2-3189s21c1
Sequence:CCGGTTACCATACACATACGTATTTCTCGAGAAATACGTATGTGTATGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-612s1c1
Sequence:CCGGGCCTCCTATACTCCTTGATAACTCGAGTTATCAAGGAGTATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-1045s1c1
Sequence:CCGGCGAGATGACAATAGTCTCATACTCGAGTATGAGACTATTGTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-1877s1c1
Sequence:CCGGGCAAAGGCATAAGATGTGAAACTCGAGTTTCACATCTTATGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-281s1c1
Sequence:CCGGGCATCCCTCTAAGGATAGTAACTCGAGTTACTATCCTTAGAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-2580s1c1
Sequence:CCGGCGAAGGTAATAGCAAGGACAACTCGAGTTGTCCTTGCTATTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016179
TRPC4 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016179.2-3189s21c1
Sequence:CCGGTTACCATACACATACGTATTTCTCGAGAAATACGTATGTGTATGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-612s1c1
Sequence:CCGGGCCTCCTATACTCCTTGATAACTCGAGTTATCAAGGAGTATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-1045s1c1
Sequence:CCGGCGAGATGACAATAGTCTCATACTCGAGTATGAGACTATTGTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-1877s1c1
Sequence:CCGGGCAAAGGCATAAGATGTGAAACTCGAGTTTCACATCTTATGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-281s1c1
Sequence:CCGGGCATCCCTCTAAGGATAGTAACTCGAGTTACTATCCTTAGAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016179.1-2580s1c1
Sequence:CCGGCGAAGGTAATAGCAAGGACAACTCGAGTTGTCCTTGCTATTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016984
TRPC4 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-568s1c1
Sequence:CCGGCCTCCCATTCTCCTTGATAAACTCGAGTTTATCAAGGAGAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-2275s1c1
Sequence:CCGGGCTGATAACTTGAGAAGACATCTCGAGATGTCTTCTCAAGTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-2069s1c1
Sequence:CCGGCCGACCATGCAGATATAGAATCTCGAGATTCTATATCTGCATGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-2606s1c1
Sequence:CCGGCCTCCGAGAGACATAACCTAACTCGAGTTAGGTTATGTCTCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-1615s1c1
Sequence:CCGGGCAGAGGCATTATTTGCTATTCTCGAGAATAGCAAATAATGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016984
TRPC4 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-568s1c1
Sequence:CCGGCCTCCCATTCTCCTTGATAAACTCGAGTTTATCAAGGAGAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-2275s1c1
Sequence:CCGGGCTGATAACTTGAGAAGACATCTCGAGATGTCTTCTCAAGTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-2069s1c1
Sequence:CCGGCCGACCATGCAGATATAGAATCTCGAGATTCTATATCTGCATGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-2606s1c1
Sequence:CCGGCCTCCGAGAGACATAACCTAACTCGAGTTAGGTTATGTCTCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-1615s1c1
Sequence:CCGGGCAGAGGCATTATTTGCTATTCTCGAGAATAGCAAATAATGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016984
TRPC4 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-568s1c1
Sequence:CCGGCCTCCCATTCTCCTTGATAAACTCGAGTTTATCAAGGAGAATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-2275s1c1
Sequence:CCGGGCTGATAACTTGAGAAGACATCTCGAGATGTCTTCTCAAGTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-2069s1c1
Sequence:CCGGCCGACCATGCAGATATAGAATCTCGAGATTCTATATCTGCATGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-2606s1c1
Sequence:CCGGCCTCCGAGAGACATAACCTAACTCGAGTTAGGTTATGTCTCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016984.1-1615s1c1
Sequence:CCGGGCAGAGGCATTATTTGCTATTCTCGAGAATAGCAAATAATGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks