EMAIL THIS PAGE TO A FRIEND

TRPC4AP

transient receptor potential cation channel, subfamily C, member 4 associated protein

Synonyms: C20orf188 TRRP4AP TRUSS
UniProtKB ID: Q8TEL6, E1P5Q1, Q96H82, Q9BVB8, Q9H429, Q9UFS6
Gene ID:
Mouse(56407) transient receptor potential cation channel, subfamily C, member 4 associated protein
Rat(362247) transient receptor potential cation channel, subfamily C, member 4 associated protein
chicken(428134) transient receptor potential cation channel, subfamily C, member 4 associated protein
dog(477207) transient receptor potential cation channel, subfamily C, member 4 associated protein
Horse(100069434) transient receptor potential cation channel, subfamily C, member 4 associated protein
domestic cat(101088152) transient receptor potential cation channel, subfamily C, member 4 associated protein
cow(532834) transient receptor potential cation channel, subfamily C, member 4 associated protein
domestic guinea pig(100712636) transient receptor potential cation channel, subfamily C, member 4 associated protein
Domestic Rabbit(100345322) transient receptor potential cation channel, subfamily C, member 4 associated protein
naked mole-rat(101701482) transient receptor potential cation channel, subfamily C, member 4 associated protein
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015638 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015638 Rosetta Predictions human pricing
NM_199368 Rosetta Predictions human pricing
NM_001100748 Rosetta Predictions rat pricing
NM_019828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137091 predicted 1370
2 SASI_Hs01_00137092 predicted 1308
3 SASI_Hs01_00137093 predicted 630
4 SASI_Hs01_00137094 predicted 227
5 SASI_Hs01_00137095 predicted 721
6 SASI_Hs01_00137096 predicted 1349
7 SASI_Hs01_00137097 predicted 627
8 SASI_Hs02_00348243 predicted 710
9 SASI_Hs01_00137100 predicted 596
10 SASI_Hs02_00348244 predicted 1798
11 SASI_Hs01_00137098 predicted 731
12 SASI_Hs01_00137099 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030349 predicted 1339
2 SASI_Hs01_00030350 predicted 1279
3 SASI_Hs01_00030351 predicted 631
4 SASI_Hs01_00030352 predicted 224
5 SASI_Hs01_00030353 predicted 712
6 SASI_Hs01_00030354 predicted 1326
7 SASI_Hs01_00030355 predicted 626
8 SASI_Hs02_00372805 predicted 717
9 SASI_Hs01_00030358 predicted 600
10 SASI_Hs02_00372806 predicted 1775
11 SASI_Hs01_00030356 predicted 732
12 SASI_Hs01_00030357 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210448 predicted 1313
2 SASI_Rn02_00210449 predicted 258
3 SASI_Rn02_00210450 predicted 510
4 SASI_Rn02_00210451 predicted 2122
5 SASI_Rn02_00210452 predicted 1240
6 SASI_Rn02_00210453 predicted 1767
7 SASI_Rn02_00210454 predicted 556
8 SASI_Rn02_00210455 predicted 1167
9 SASI_Rn02_00210456 predicted 238
10 SASI_Rn02_00210457 predicted 1460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185810 predicted 1043
2 SASI_Mm01_00185811 predicted 1131
3 SASI_Mm01_00185812 predicted 241
4 SASI_Mm01_00185813 predicted 1255
5 SASI_Mm01_00185814 predicted 1203
6 SASI_Mm01_00185815 predicted 613
7 SASI_Mm01_00185816 predicted 317
8 SASI_Mm01_00185817 predicted 2361
9 SASI_Mm02_00325123 predicted 227
10 SASI_Mm01_00185818 predicted 926
11 SASI_Mm01_00185819 predicted 720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019828
VALIDATED
TRPC4AP MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 4 associated protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-693s1c1
Sequence:CCGGCGGCTAGATGAAGTTCCCAATCTCGAGATTGGGAACTTCATCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019828.1-215s1c1
Sequence:CCGGCGAGAGGGACAAATTGTCCAACTCGAGTTGGACAATTTGTCCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-807s1c1
Sequence:CCGGGACGACAAACACACGCTTCTTCTCGAGAAGAAGCGTGTGTTTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-1253s1c1
Sequence:CCGGCCCAGGACTCAATAATTTGTTCTCGAGAACAAATTATTGAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-1767s1c1
Sequence:CCGGCTGATGAAGTTCAACGTCGATCTCGAGATCGACGTTGAACTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019828
VALIDATED
TRPC4AP MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 4 associated protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-693s1c1
Sequence:CCGGCGGCTAGATGAAGTTCCCAATCTCGAGATTGGGAACTTCATCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019828.1-215s1c1
Sequence:CCGGCGAGAGGGACAAATTGTCCAACTCGAGTTGGACAATTTGTCCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-807s1c1
Sequence:CCGGGACGACAAACACACGCTTCTTCTCGAGAAGAAGCGTGTGTTTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-1253s1c1
Sequence:CCGGCCCAGGACTCAATAATTTGTTCTCGAGAACAAATTATTGAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-1767s1c1
Sequence:CCGGCTGATGAAGTTCAACGTCGATCTCGAGATCGACGTTGAACTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019828
VALIDATED
TRPC4AP MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 4 associated protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-693s1c1
Sequence:CCGGCGGCTAGATGAAGTTCCCAATCTCGAGATTGGGAACTTCATCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019828.1-215s1c1
Sequence:CCGGCGAGAGGGACAAATTGTCCAACTCGAGTTGGACAATTTGTCCCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-807s1c1
Sequence:CCGGGACGACAAACACACGCTTCTTCTCGAGAAGAAGCGTGTGTTTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-1253s1c1
Sequence:CCGGCCCAGGACTCAATAATTTGTTCTCGAGAACAAATTATTGAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019828.1-1767s1c1
Sequence:CCGGCTGATGAAGTTCAACGTCGATCTCGAGATCGACGTTGAACTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015638
TRPC4AP MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 4 associated protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-656s1c1
Sequence:CCGGGCAACCCTCATTGAAGATATTCTCGAGAATATCTTCAATGAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-717s1c1
Sequence:CCGGCCAATCTGAGTTCCTTAGTATCTCGAGATACTAAGGAACTCAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-1382s1c1
Sequence:CCGGCCGGACATCACCTTGAAGATACTCGAGTATCTTCAAGGTGATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-531s1c1
Sequence:CCGGGCTTGAGTATCCTGTATAATACTCGAGTATTATACAGGATACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-2206s1c1
Sequence:CCGGCCTGCTCAACAACTTCCACAACTCGAGTTGTGGAAGTTGTTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015638.2-1928s21c1
Sequence:CCGGACTCTGTCCCTGGACCGATTTCTCGAGAAATCGGTCCAGGGACAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015638.2-1279s21c1
Sequence:CCGGGCTGATCCCTGGACTTAATAACTCGAGTTATTAAGTCCAGGGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015638.2-442s21c1
Sequence:CCGGTGTTGATCTTCTTGTAGAAATCTCGAGATTTCTACAAGAAGATCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015638
TRPC4AP MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 4 associated protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-656s1c1
Sequence:CCGGGCAACCCTCATTGAAGATATTCTCGAGAATATCTTCAATGAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-717s1c1
Sequence:CCGGCCAATCTGAGTTCCTTAGTATCTCGAGATACTAAGGAACTCAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-1382s1c1
Sequence:CCGGCCGGACATCACCTTGAAGATACTCGAGTATCTTCAAGGTGATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-531s1c1
Sequence:CCGGGCTTGAGTATCCTGTATAATACTCGAGTATTATACAGGATACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-2206s1c1
Sequence:CCGGCCTGCTCAACAACTTCCACAACTCGAGTTGTGGAAGTTGTTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015638.2-1928s21c1
Sequence:CCGGACTCTGTCCCTGGACCGATTTCTCGAGAAATCGGTCCAGGGACAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015638.2-1279s21c1
Sequence:CCGGGCTGATCCCTGGACTTAATAACTCGAGTTATTAAGTCCAGGGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015638.2-442s21c1
Sequence:CCGGTGTTGATCTTCTTGTAGAAATCTCGAGATTTCTACAAGAAGATCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015638
TRPC4AP MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 4 associated protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-656s1c1
Sequence:CCGGGCAACCCTCATTGAAGATATTCTCGAGAATATCTTCAATGAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-717s1c1
Sequence:CCGGCCAATCTGAGTTCCTTAGTATCTCGAGATACTAAGGAACTCAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-1382s1c1
Sequence:CCGGCCGGACATCACCTTGAAGATACTCGAGTATCTTCAAGGTGATGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-531s1c1
Sequence:CCGGGCTTGAGTATCCTGTATAATACTCGAGTATTATACAGGATACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015638.2-2206s1c1
Sequence:CCGGCCTGCTCAACAACTTCCACAACTCGAGTTGTGGAAGTTGTTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015638.2-1928s21c1
Sequence:CCGGACTCTGTCCCTGGACCGATTTCTCGAGAAATCGGTCCAGGGACAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015638.2-1279s21c1
Sequence:CCGGGCTGATCCCTGGACTTAATAACTCGAGTTATTAAGTCCAGGGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015638.2-442s21c1
Sequence:CCGGTGTTGATCTTCTTGTAGAAATCTCGAGATTTCTACAAGAAGATCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks