EMAIL THIS PAGE TO A FRIEND

TRPC5

transient receptor potential cation channel, subfamily C, member 5

Synonyms: TRP5
UniProtKB ID: Q9UL62, B2RP53, O75233, Q5JXY8, Q9Y514
Gene ID:
Human(7224) Summary: This gene belongs to the transient receptor family. It encodes one of the seven mammalian TRPC (transient receptor potential channel) proteins. The encoded protein is a multi-pass membrane protein and is thought to form a receptor-activated non-selective calcium permeant cation channel. The protein is active alone or as a heteromultimeric assembly with TRPC1, TRPC3, and TRPC4. It also interacts with multiple proteins including calmodulin, CABP1, enkurin, Na(+)-H+ exchange regulatory factor (NHERF ), interferon-induced GTP-binding protein (MX1), ring finger protein 24 (RNF24), and SEC14 domain and spectrin repeat-containing protein 1 (SESTD1). [provided by RefSeq, May 2010]
Mouse(22067) transient receptor potential cation channel, subfamily C, member 5
Rat(140933) transient receptor potential cation channel, subfamily C, member 5
chicken(422337) transient receptor potential cation channel, subfamily C, member 5
domestic cat(101096211) transient receptor potential cation channel, subfamily C, member 5
dog(492072) transient receptor potential cation channel, subfamily C, member 5
naked mole-rat(101709576) transient receptor potential cation channel, subfamily C, member 5
domestic guinea pig(100719495) transient receptor potential cation channel, subfamily C, member 5
cow(407103) transient receptor potential cation channel, subfamily C, member 5
sheep(101109334) transient receptor potential cation channel, subfamily C, member 5
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012471 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039341 MISSION® esiRNA esiRNA human TRPC5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012471 Rosetta Predictions human pricing
NM_080898 Rosetta Predictions rat pricing
NM_009428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085693 predicted 2692
2 SASI_Hs01_00085694 predicted 943
3 SASI_Hs01_00085695 predicted 2789
4 SASI_Hs01_00085696 predicted 2784
5 SASI_Hs01_00085697 predicted 3155
6 SASI_Hs01_00085698 predicted 2511
7 SASI_Hs02_00344384 predicted 1082
8 SASI_Hs01_00085699 predicted 2543
9 SASI_Hs01_00085700 predicted 3555
10 SASI_Hs01_00085701 predicted 1202
11 SASI_Hs01_00085702 predicted 3461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122002 predicted 2237
2 SASI_Rn02_00267351 predicted 713
3 SASI_Rn01_00122003 predicted 275
4 SASI_Rn01_00122004 predicted 1635
5 SASI_Rn01_00122005 predicted 2247
6 SASI_Rn01_00122006 predicted 1802
7 SASI_Rn01_00122007 predicted 2124
8 SASI_Rn01_00122009 predicted 1561
9 SASI_Rn02_00267352 predicted 1784
10 SASI_Rn01_00122010 predicted 1288
11 SASI_Rn01_00122008 predicted 2902
12 SASI_Rn01_00122011 predicted 1547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055936 predicted 953
2 SASI_Mm01_00055937 predicted 2035
3 SASI_Mm01_00055938 predicted 2976
4 SASI_Mm02_00316106 predicted 676
5 SASI_Mm01_00055939 predicted 2541
6 SASI_Mm01_00055940 predicted 2663
7 SASI_Mm01_00055941 predicted 2144
8 SASI_Mm01_00055944 predicted 2194
9 SASI_Mm01_00055945 predicted 2206
10 SASI_Mm02_00316107 predicted 2564
11 SASI_Mm01_00055942 predicted 979
12 SASI_Mm01_00055943 predicted 2540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009428
TRPC5 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000449041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009428.2-1845s21c1
Sequence:CCGGTCTTCGCAATATCCAACATTTCTCGAGAAATGTTGGATATTGCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009428.2-2295s21c1
Sequence:CCGGTTGCCGATCATGCTGATATTGCTCGAGCAATATCAGCATGATCGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-2144s1c1
Sequence:CCGGGCCTCCTAAATCTCTATGTTACTCGAGTAACATAGAGATTTAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-1941s1c1
Sequence:CCGGGCTGCTTGATATACTCAAATTCTCGAGAATTTGAGTATATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-1740s1c1
Sequence:CCGGCCTGGCAACTATTTCCTTGAACTCGAGTTCAAGGAAATAGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-3027s1c1
Sequence:CCGGGCATTGTATGTGGCAGGACATCTCGAGATGTCCTGCCACATACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-2954s1c1
Sequence:CCGGCCAAGTTCAATGGTCAAACATCTCGAGATGTTTGACCATTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009428
TRPC5 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000449041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009428.2-1845s21c1
Sequence:CCGGTCTTCGCAATATCCAACATTTCTCGAGAAATGTTGGATATTGCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009428.2-2295s21c1
Sequence:CCGGTTGCCGATCATGCTGATATTGCTCGAGCAATATCAGCATGATCGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-2144s1c1
Sequence:CCGGGCCTCCTAAATCTCTATGTTACTCGAGTAACATAGAGATTTAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-1941s1c1
Sequence:CCGGGCTGCTTGATATACTCAAATTCTCGAGAATTTGAGTATATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-1740s1c1
Sequence:CCGGCCTGGCAACTATTTCCTTGAACTCGAGTTCAAGGAAATAGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-3027s1c1
Sequence:CCGGGCATTGTATGTGGCAGGACATCTCGAGATGTCCTGCCACATACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-2954s1c1
Sequence:CCGGCCAAGTTCAATGGTCAAACATCTCGAGATGTTTGACCATTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009428
TRPC5 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000449041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009428.2-1845s21c1
Sequence:CCGGTCTTCGCAATATCCAACATTTCTCGAGAAATGTTGGATATTGCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009428.2-2295s21c1
Sequence:CCGGTTGCCGATCATGCTGATATTGCTCGAGCAATATCAGCATGATCGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-2144s1c1
Sequence:CCGGGCCTCCTAAATCTCTATGTTACTCGAGTAACATAGAGATTTAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-1941s1c1
Sequence:CCGGGCTGCTTGATATACTCAAATTCTCGAGAATTTGAGTATATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-1740s1c1
Sequence:CCGGCCTGGCAACTATTTCCTTGAACTCGAGTTCAAGGAAATAGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-3027s1c1
Sequence:CCGGGCATTGTATGTGGCAGGACATCTCGAGATGTCCTGCCACATACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009428.1-2954s1c1
Sequence:CCGGCCAAGTTCAATGGTCAAACATCTCGAGATGTTTGACCATTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012471
TRPC5 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 5
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000413351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012471.2-2122s21c1
Sequence:CCGGTGTCGTGGAATGGATGATATTCTCGAGAATATCATCCATTCCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012471.2-3466s21c1
Sequence:CCGGCTCCAAATTTAATGGTCATATCTCGAGATATGACCATTAAATTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012471.1-2256s1c1
Sequence:CCGGCCTGGCAACTATTTCCCTGAACTCGAGTTCAGGGAAATAGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012471.1-2917s1c1
Sequence:CCGGCCCAAGTCATTTCTATACCTTCTCGAGAAGGTATAGAAATGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012471
TRPC5 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 5
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000413351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012471.2-2122s21c1
Sequence:CCGGTGTCGTGGAATGGATGATATTCTCGAGAATATCATCCATTCCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012471.2-3466s21c1
Sequence:CCGGCTCCAAATTTAATGGTCATATCTCGAGATATGACCATTAAATTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012471.1-2256s1c1
Sequence:CCGGCCTGGCAACTATTTCCCTGAACTCGAGTTCAGGGAAATAGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012471.1-2917s1c1
Sequence:CCGGCCCAAGTCATTTCTATACCTTCTCGAGAAGGTATAGAAATGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012471
TRPC5 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 5
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000413351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012471.2-2122s21c1
Sequence:CCGGTGTCGTGGAATGGATGATATTCTCGAGAATATCATCCATTCCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012471.2-3466s21c1
Sequence:CCGGCTCCAAATTTAATGGTCATATCTCGAGATATGACCATTAAATTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012471.1-2256s1c1
Sequence:CCGGCCTGGCAACTATTTCCCTGAACTCGAGTTCAGGGAAATAGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012471.1-2917s1c1
Sequence:CCGGCCCAAGTCATTTCTATACCTTCTCGAGAAGGTATAGAAATGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks