EMAIL THIS PAGE TO A FRIEND

TRPC6

transient receptor potential cation channel, subfamily C, member 6

Synonyms: FSGS2 TRP6
UniProtKB ID: Q9Y210, Q52M59, Q9HCW3, Q9NQA8, Q9NQA9
Gene ID:
Human(7225) Summary: The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
Mouse(22068) transient receptor potential cation channel, subfamily C, member 6
Rat(89823) transient receptor potential cation channel, subfamily C, member 6
cow(407151) transient receptor potential cation channel, subfamily C, member 6
sheep(101121117) transient receptor potential cation channel, subfamily C, member 6
domestic guinea pig(100135637) transient receptor potential cation channel, subfamily C, member 6
naked mole-rat(101722559) transient receptor potential cation channel, subfamily C, member 6
Domestic Rabbit(100347206) transient receptor potential cation channel, subfamily C, member 6
chicken(418989) transient receptor potential cation channel, subfamily C, member 6
domestic cat(101082685) transient receptor potential cation channel, subfamily C, member 6
Horse(100061175) transient receptor potential cation channel, subfamily C, member 6
dog(489435) transient receptor potential cation channel, subfamily C, member 6
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS3897 Anti-TRPC6 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS3899 Anti-TRPC6 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2501066 Anti-TRPC6 (C-Term) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine
ELISA, western blot pricing
SAB2501065 Anti-TRPC6 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human
ELISA, flow cytometry pricing
SAB2102583 Anti-TRPC6 antibody produced in rabbit affinity isolated antibody pig, guinea pig, human, mouse, rat, horse
western blot pricing
SAB4300572 Anti-TRPC6 antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
T6442 Anti-TRPC6 antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, rat
immunohistochemistry, western blot pricing
HPA045098 Anti-TRPC6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA062164 Anti-TRPC6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2103237 Anti-TRPC6, (N-terminal) antibody produced in rabbit affinity isolated antibody human, mouse, rat, horse
western blot pricing
SAB3701466 Monoclonal Anti-TRPC6 antibody produced in mouse clone 3F2.H10.F2, purified immunoglobulin human, chimpanzee
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004621 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116361 MISSION® esiRNA esiRNA human TRPC6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004621 Rosetta Predictions human pricing
NM_053559 Rosetta Predictions rat pricing
NM_013838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338017 predicted 1159
2 SASI_Hs01_00241306 predicted 1153
3 SASI_Hs01_00241308 predicted 1396
4 SASI_Hs01_00241309 predicted 2108
5 SASI_Hs02_00338018 predicted 1590
6 SASI_Hs01_00241310 predicted 2339
7 SASI_Hs01_00241312 predicted 1322
8 SASI_Hs01_00241313 predicted 1622
9 SASI_Hs01_00241315 predicted 1504
10 SASI_Hs02_00338019 predicted 805
11 SASI_Hs01_00241307 predicted 3101
12 SASI_Hs01_00241311 predicted 2541
13 SASI_Hs01_00241314 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080074 predicted 227
2 SASI_Rn01_00080075 predicted 670
3 SASI_Rn01_00080076 predicted 1366
4 SASI_Rn02_00266217 predicted 1771
5 SASI_Rn01_00080078 predicted 725
6 SASI_Rn01_00080079 predicted 2338
7 SASI_Rn01_00080081 predicted 1997
8 SASI_Rn01_00080082 predicted 1783
9 SASI_Rn01_00080083 predicted 265
10 SASI_Rn02_00266218 predicted 2320
11 SASI_Rn01_00080077 predicted 1292
12 SASI_Rn01_00080080 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045882 predicted 522
2 SASI_Mm01_00045883 predicted 959
3 SASI_Mm01_00045884 predicted 1017
4 SASI_Mm02_00322835 predicted 537
5 SASI_Mm01_00045885 predicted 2049
6 SASI_Mm01_00045886 predicted 2355
7 SASI_Mm01_00045887 predicted 2604
8 SASI_Mm01_00045890 predicted 2339
9 SASI_Mm01_00045891 predicted 1367
10 SASI_Mm02_00322836 predicted 1188
11 SASI_Mm01_00045888 predicted 2373
12 SASI_Mm01_00045889 predicted 2808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013838
TRPC6 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000068394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-1775s1c1
Sequence:CCGGGCTCATTATATCCTGGGTAATCTCGAGATTACCCAGGATATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-1365s1c1
Sequence:CCGGCGTCCAAATCTCAGCCGTTTACTCGAGTAAACGGCTGAGATTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-963s1c1
Sequence:CCGGGCTGCACATTGCCAGGAATATCTCGAGATATTCCTGGCAATGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-2402s1c1
Sequence:CCGGCGTTCTGTATGGTGTCTATAACTCGAGTTATAGACACCATACAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013838
TRPC6 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000068394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-1775s1c1
Sequence:CCGGGCTCATTATATCCTGGGTAATCTCGAGATTACCCAGGATATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-1365s1c1
Sequence:CCGGCGTCCAAATCTCAGCCGTTTACTCGAGTAAACGGCTGAGATTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-963s1c1
Sequence:CCGGGCTGCACATTGCCAGGAATATCTCGAGATATTCCTGGCAATGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-2402s1c1
Sequence:CCGGCGTTCTGTATGGTGTCTATAACTCGAGTTATAGACACCATACAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013838
TRPC6 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000068394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-1775s1c1
Sequence:CCGGGCTCATTATATCCTGGGTAATCTCGAGATTACCCAGGATATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-1365s1c1
Sequence:CCGGCGTCCAAATCTCAGCCGTTTACTCGAGTAAACGGCTGAGATTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-963s1c1
Sequence:CCGGGCTGCACATTGCCAGGAATATCTCGAGATATTCCTGGCAATGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013838.1-2402s1c1
Sequence:CCGGCGTTCTGTATGGTGTCTATAACTCGAGTTATAGACACCATACAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004621
TRPC6 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-1926s1c1
Sequence:CCGGCCTGGGTAATAGGCATGATATCTCGAGATATCATGCCTATTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-2917s1c1
Sequence:CCGGGCACAATAAACAACCAAGTATCTCGAGATACTTGGTTGTTTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-852s1c1
Sequence:CCGGCCAATGAGCATCTGGAAATTACTCGAGTAATTTCCAGATGCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-2089s1c1
Sequence:CCGGCCAGAGCATCATTGACGCAAACTCGAGTTTGCGTCAATGATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004621.5-1299s21c1
Sequence:CCGGGATCCAGTCATGACGGCTTTACTCGAGTAAAGCCGTCATGACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004621.5-3255s21c1
Sequence:CCGGGTCCACTTGAAGCCATATTATCTCGAGATAATATGGCTTCAAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004621.5-1505s21c1
Sequence:CCGGCCCAAATCTCAGCCGTTTAAACTCGAGTTTAAACGGCTGAGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004621
TRPC6 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-1926s1c1
Sequence:CCGGCCTGGGTAATAGGCATGATATCTCGAGATATCATGCCTATTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-2917s1c1
Sequence:CCGGGCACAATAAACAACCAAGTATCTCGAGATACTTGGTTGTTTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-852s1c1
Sequence:CCGGCCAATGAGCATCTGGAAATTACTCGAGTAATTTCCAGATGCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-2089s1c1
Sequence:CCGGCCAGAGCATCATTGACGCAAACTCGAGTTTGCGTCAATGATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004621.5-1299s21c1
Sequence:CCGGGATCCAGTCATGACGGCTTTACTCGAGTAAAGCCGTCATGACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004621.5-3255s21c1
Sequence:CCGGGTCCACTTGAAGCCATATTATCTCGAGATAATATGGCTTCAAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004621.5-1505s21c1
Sequence:CCGGCCCAAATCTCAGCCGTTTAAACTCGAGTTTAAACGGCTGAGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004621
TRPC6 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-1926s1c1
Sequence:CCGGCCTGGGTAATAGGCATGATATCTCGAGATATCATGCCTATTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-2917s1c1
Sequence:CCGGGCACAATAAACAACCAAGTATCTCGAGATACTTGGTTGTTTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-852s1c1
Sequence:CCGGCCAATGAGCATCTGGAAATTACTCGAGTAATTTCCAGATGCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004621.3-2089s1c1
Sequence:CCGGCCAGAGCATCATTGACGCAAACTCGAGTTTGCGTCAATGATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004621.5-1299s21c1
Sequence:CCGGGATCCAGTCATGACGGCTTTACTCGAGTAAAGCCGTCATGACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004621.5-3255s21c1
Sequence:CCGGGTCCACTTGAAGCCATATTATCTCGAGATAATATGGCTTCAAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004621.5-1505s21c1
Sequence:CCGGCCCAAATCTCAGCCGTTTAAACTCGAGTTTAAACGGCTGAGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks