EMAIL THIS PAGE TO A FRIEND

TRPC7

transient receptor potential cation channel, subfamily C, member 7

Synonyms: TRP7
UniProtKB ID: Q9HCX4, A1A4Z4, F5H5U9, Q70T26, Q8IWP7
Gene ID:
Mouse(26946) transient receptor potential cation channel, subfamily C, member 7
Rat(282822) transient receptor potential cation channel, subfamily C, member 7
chicken(427641) transient receptor potential cation channel, subfamily C, member 7
domestic cat(101082037) transient receptor potential cation channel, subfamily C, member 7
dog(481521) transient receptor potential cation channel, subfamily C, member 7
naked mole-rat(101701658) transient receptor potential cation channel, subfamily C, member 7
domestic guinea pig(100732031) transient receptor potential cation channel, subfamily C, member 7
cow(540902) transient receptor potential cation channel, subfamily C, member 7
sheep(101106522) transient receptor potential cation channel, subfamily C, member 7
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020389 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078231 MISSION® esiRNA esiRNA human TRPC7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020389 Rosetta Predictions human pricing
XM_001067646 Rosetta Predictions rat pricing
XM_225159 Rosetta Predictions rat pricing
NM_012035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174319 predicted 950
2 SASI_Hs02_00353361 predicted 1026
3 SASI_Hs01_00174320 predicted 1314
4 SASI_Hs01_00174322 predicted 1249
5 SASI_Hs01_00174323 predicted 196
6 SASI_Hs01_00174325 predicted 749
7 SASI_Hs01_00174326 predicted 738
8 SASI_Hs02_00353362 predicted 1457
9 SASI_Hs02_00353363 predicted 1180
10 SASI_Hs01_00174327 predicted 927
11 SASI_Hs01_00174321 predicted 1302
12 SASI_Hs01_00174324 predicted 1066
13 SASI_Hs01_00174328 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321692 predicted 2704
2 SASI_Rn02_00321693 predicted 425
3 SASI_Rn02_00321694 predicted 2900
4 SASI_Rn02_00321695 predicted 2427
5 SASI_Rn02_00321696 predicted 1020
6 SASI_Rn02_00321697 predicted 2439
7 SASI_Rn02_00321698 predicted 2281
8 SASI_Rn02_00321699 predicted 2107
9 SASI_Rn02_00321700 predicted 2068
10 SASI_Rn02_00321701 predicted 2872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382557 predicted 269
2 SASI_Rn02_00382558 predicted 257
3 SASI_Rn02_00382559 predicted 306
4 SASI_Rn02_00382560 predicted 372
5 SASI_Rn02_00382561 predicted 198
6 SASI_Rn02_00382562 predicted 310
7 SASI_Rn02_00382563 predicted 305
8 SASI_Rn02_00382564 predicted 379
9 SASI_Rn02_00382565 predicted 245
10 SASI_Rn02_00382566 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058780 predicted 2537
2 SASI_Mm01_00058781 predicted 1016
3 SASI_Mm01_00058782 predicted 2712
4 SASI_Mm01_00058783 predicted 2250
5 SASI_Mm01_00058784 predicted 614
6 SASI_Mm01_00058785 predicted 1319
7 SASI_Mm02_00322003 predicted 2398
8 SASI_Mm01_00058786 predicted 1342
9 SASI_Mm01_00058787 predicted 1926
10 SASI_Mm01_00058788 predicted 1414
11 SASI_Mm01_00058789 predicted 2297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020389
TRPC7 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-928s1c1
Sequence:CCGGCGGATCAAACTCGCCATTAAACTCGAGTTTAATGGCGAGTTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-1323s1c1
Sequence:CCGGGCTCATTATGAAGTGGGTCTTCTCGAGAAGACCCACTTCATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-1819s1c1
Sequence:CCGGGCCAAATACAACCCAGCGTTTCTCGAGAAACGCTGGGTTGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-1920s1c1
Sequence:CCGGCGACCACAAATTCATCGAGAACTCGAGTTCTCGATGAATTTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-87s1c1
Sequence:CCGGCGCCTACATGTTCAACGAGAACTCGAGTTCTCGTTGAACATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020389
TRPC7 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-928s1c1
Sequence:CCGGCGGATCAAACTCGCCATTAAACTCGAGTTTAATGGCGAGTTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-1323s1c1
Sequence:CCGGGCTCATTATGAAGTGGGTCTTCTCGAGAAGACCCACTTCATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-1819s1c1
Sequence:CCGGGCCAAATACAACCCAGCGTTTCTCGAGAAACGCTGGGTTGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-1920s1c1
Sequence:CCGGCGACCACAAATTCATCGAGAACTCGAGTTCTCGATGAATTTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-87s1c1
Sequence:CCGGCGCCTACATGTTCAACGAGAACTCGAGTTCTCGTTGAACATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020389
TRPC7 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-928s1c1
Sequence:CCGGCGGATCAAACTCGCCATTAAACTCGAGTTTAATGGCGAGTTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-1323s1c1
Sequence:CCGGGCTCATTATGAAGTGGGTCTTCTCGAGAAGACCCACTTCATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-1819s1c1
Sequence:CCGGGCCAAATACAACCCAGCGTTTCTCGAGAAACGCTGGGTTGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-1920s1c1
Sequence:CCGGCGACCACAAATTCATCGAGAACTCGAGTTCTCGATGAATTTGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020389.1-87s1c1
Sequence:CCGGCGCCTACATGTTCAACGAGAACTCGAGTTCTCGTTGAACATGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012035
TRPC7 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily C, member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-1020s1c1
Sequence:CCGGGCCGAATCAAACTCGCCATTACTCGAGTAATGGCGAGTTTGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-851s1c1
Sequence:CCGGGCCAACATTGAGACTGAATTTCTCGAGAAATTCAGTCTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-1913s1c1
Sequence:CCGGGCAAAGTACAACCCAGCGTTTCTCGAGAAACGCTGGGTTGTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-2184s1c1
Sequence:CCGGCTTACTTTGATGAAGGAAGAACTCGAGTTCTTCCTTCATCAAAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-1126s1c1
Sequence:CCGGGCAACAGTCTATCGCTGTGAACTCGAGTTCACAGCGATAGACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012035
TRPC7 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily C, member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-1020s1c1
Sequence:CCGGGCCGAATCAAACTCGCCATTACTCGAGTAATGGCGAGTTTGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-851s1c1
Sequence:CCGGGCCAACATTGAGACTGAATTTCTCGAGAAATTCAGTCTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-1913s1c1
Sequence:CCGGGCAAAGTACAACCCAGCGTTTCTCGAGAAACGCTGGGTTGTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-2184s1c1
Sequence:CCGGCTTACTTTGATGAAGGAAGAACTCGAGTTCTTCCTTCATCAAAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-1126s1c1
Sequence:CCGGGCAACAGTCTATCGCTGTGAACTCGAGTTCACAGCGATAGACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012035
TRPC7 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily C, member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-1020s1c1
Sequence:CCGGGCCGAATCAAACTCGCCATTACTCGAGTAATGGCGAGTTTGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-851s1c1
Sequence:CCGGGCCAACATTGAGACTGAATTTCTCGAGAAATTCAGTCTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-1913s1c1
Sequence:CCGGGCAAAGTACAACCCAGCGTTTCTCGAGAAACGCTGGGTTGTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-2184s1c1
Sequence:CCGGCTTACTTTGATGAAGGAAGAACTCGAGTTCTTCCTTCATCAAAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012035.1-1126s1c1
Sequence:CCGGGCAACAGTCTATCGCTGTGAACTCGAGTTCACAGCGATAGACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks