EMAIL THIS PAGE TO A FRIEND

TRPM1

transient receptor potential cation channel, subfamily M, member 1

Synonyms: CSNB1C LTRPC1 MLSN1
Gene ID:
Human(4308) Summary: This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Mouse(17364) transient receptor potential cation channel, subfamily M, member 1
Rat(361586) transient receptor potential cation channel, subfamily M, member 1
Zebrafish(100329474) transient receptor potential cation channel, subfamily M, member 1
chicken(427494) transient receptor potential cation channel, subfamily M, member 1
dog(488699) transient receptor potential cation channel, subfamily M, member 1
Horse(100059740) transient receptor potential cation channel, subfamily M, member 1
domestic cat(101086232) transient receptor potential cation channel, subfamily M, member 1
cow(527638) transient receptor potential cation channel, subfamily M, member 1
sheep(101118732) transient receptor potential cation channel, subfamily M, member 1
domestic guinea pig(100719532) transient receptor potential cation channel, subfamily M, member 1
naked mole-rat(101720797) transient receptor potential cation channel, subfamily M, member 1
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002420 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002420 Rosetta Predictions human pricing
NM_001037733 Rosetta Predictions rat pricing
NM_001037734 Rosetta Predictions rat pricing
NM_001039104 Rosetta Predictions mouse pricing
NM_018752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131849 predicted 2427
2 SASI_Hs01_00131850 predicted 3291
3 SASI_Hs01_00131851 predicted 3354
4 SASI_Hs01_00131852 predicted 2575
5 SASI_Hs01_00131853 predicted 4320
6 SASI_Hs01_00131854 predicted 3106
7 SASI_Hs01_00131855 predicted 2556
8 SASI_Hs02_00333813 predicted 3543
9 SASI_Hs01_00131856 predicted 2756
10 SASI_Hs01_00131857 predicted 3398
11 SASI_Hs01_00131858 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113435 predicted 3598
2 SASI_Rn01_00113437 predicted 1724
3 SASI_Rn02_00204549 predicted 215
4 SASI_Rn01_00113438 predicted 2722
5 SASI_Rn01_00113439 predicted 438
6 SASI_Rn01_00113440 predicted 477
7 SASI_Rn01_00113441 predicted 3076
8 SASI_Rn01_00113442 predicted 2565
9 SASI_Rn01_00113443 predicted 2578
10 SASI_Rn01_00113444 predicted 2357
11 SASI_Rn01_00113436 predicted 2641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068593 predicted 3621
2 SASI_Rn01_00068595 predicted 1719
3 SASI_Rn02_00204550 predicted 218
4 SASI_Rn01_00068596 predicted 2724
5 SASI_Rn01_00068597 predicted 433
6 SASI_Rn01_00068598 predicted 477
7 SASI_Rn01_00068599 predicted 3077
8 SASI_Rn01_00068600 predicted 2566
9 SASI_Rn01_00068601 predicted 2585
10 SASI_Rn01_00068602 predicted 2355
11 SASI_Rn01_00068594 predicted 2647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289784 predicted 1773
2 SASI_Mm02_00289785 predicted 1303
3 SASI_Mm02_00289786 predicted 489
4 SASI_Mm02_00289787 predicted 1386
5 SASI_Mm02_00289788 predicted 1467
6 SASI_Mm02_00289789 predicted 1301
7 SASI_Mm02_00289790 predicted 1306
8 SASI_Mm02_00289791 predicted 1254
9 SASI_Mm02_00289792 predicted 1735
10 SASI_Mm02_00289793 predicted 533
11 SASI_Mm01_00165191 predicted 1390
12 SASI_Mm01_00165192 predicted 925
13 SASI_Mm01_00165193 predicted 1131
14 SASI_Mm01_00165194 predicted 1395
15 SASI_Mm01_00165195 predicted 913
16 SASI_Mm01_00165196 predicted 1008
17 SASI_Mm01_00165197 predicted 1499
18 SASI_Mm01_00165198 predicted 1486
19 SASI_Mm01_00165199 predicted 1413
20 SASI_Mm01_00165200 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324030 predicted 1109
2 SASI_Mm02_00324031 predicted 513
3 SASI_Mm02_00324032 predicted 1274
4 SASI_Mm02_00324033 predicted 704
5 SASI_Mm02_00324034 predicted 548
6 SASI_Mm02_00324035 predicted 1196
7 SASI_Mm02_00324036 predicted 1282
8 SASI_Mm02_00324037 predicted 561
9 SASI_Mm02_00324038 predicted 1148
10 SASI_Mm02_00324039 predicted 964
11 SASI_Mm01_00188929 predicted 3723
12 SASI_Mm01_00188930 predicted 3246
13 SASI_Mm01_00188931 predicted 3456
14 SASI_Mm01_00188932 predicted 3719
15 SASI_Mm01_00188933 predicted 3237
16 SASI_Mm01_00188934 predicted 3334
17 SASI_Mm01_00188935 predicted 3822
18 SASI_Mm01_00188936 predicted 3809
19 SASI_Mm01_00188937 predicted 3729
20 SASI_Mm01_00188938 predicted 3260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002420
TRPM1 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002420.4-5156s21c1
Sequence:CCGGATGATACTGTAACGAAGATAACTCGAGTTATCTTCGTTACAGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002420.4-3213s21c1
Sequence:CCGGCCTTGTGGTGAGAACCTATATCTCGAGATATAGGTTCTCACCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002420.4-3405s21c1
Sequence:CCGGCAGCGATATCAGCTGATTATGCTCGAGCATAATCAGCTGATATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-4339s1c1
Sequence:CCGGCGACAAATATAGAAGGCACTACTCGAGTAGTGCCTTCTATATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-1055s1c1
Sequence:CCGGGCTTCTAGTTACCATTCAGAACTCGAGTTCTGAATGGTAACTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-2158s1c1
Sequence:CCGGGCCAGCTTGCTTTGGAGTTATCTCGAGATAACTCCAAAGCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-4845s1c1
Sequence:CCGGGCCAGTAGTGTAAGCAGCTTACTCGAGTAAGCTGCTTACACTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-3549s1c1
Sequence:CCGGCGTGGATTGAAGCTCTTCCTTCTCGAGAAGGAAGAGCTTCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002420
TRPM1 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002420.4-5156s21c1
Sequence:CCGGATGATACTGTAACGAAGATAACTCGAGTTATCTTCGTTACAGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002420.4-3213s21c1
Sequence:CCGGCCTTGTGGTGAGAACCTATATCTCGAGATATAGGTTCTCACCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002420.4-3405s21c1
Sequence:CCGGCAGCGATATCAGCTGATTATGCTCGAGCATAATCAGCTGATATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-4339s1c1
Sequence:CCGGCGACAAATATAGAAGGCACTACTCGAGTAGTGCCTTCTATATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-1055s1c1
Sequence:CCGGGCTTCTAGTTACCATTCAGAACTCGAGTTCTGAATGGTAACTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-2158s1c1
Sequence:CCGGGCCAGCTTGCTTTGGAGTTATCTCGAGATAACTCCAAAGCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-4845s1c1
Sequence:CCGGGCCAGTAGTGTAAGCAGCTTACTCGAGTAAGCTGCTTACACTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-3549s1c1
Sequence:CCGGCGTGGATTGAAGCTCTTCCTTCTCGAGAAGGAAGAGCTTCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002420
TRPM1 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002420.4-5156s21c1
Sequence:CCGGATGATACTGTAACGAAGATAACTCGAGTTATCTTCGTTACAGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002420.4-3213s21c1
Sequence:CCGGCCTTGTGGTGAGAACCTATATCTCGAGATATAGGTTCTCACCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002420.4-3405s21c1
Sequence:CCGGCAGCGATATCAGCTGATTATGCTCGAGCATAATCAGCTGATATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-4339s1c1
Sequence:CCGGCGACAAATATAGAAGGCACTACTCGAGTAGTGCCTTCTATATTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-1055s1c1
Sequence:CCGGGCTTCTAGTTACCATTCAGAACTCGAGTTCTGAATGGTAACTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-2158s1c1
Sequence:CCGGGCCAGCTTGCTTTGGAGTTATCTCGAGATAACTCCAAAGCAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-4845s1c1
Sequence:CCGGGCCAGTAGTGTAAGCAGCTTACTCGAGTAAGCTGCTTACACTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002420.3-3549s1c1
Sequence:CCGGCGTGGATTGAAGCTCTTCCTTCTCGAGAAGGAAGAGCTTCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358370
TRPM1 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-1543s1c1
Sequence:CCGGCGGAGTGAACATGCAGCATTTCTCGAGAAATGCTGCATGTTCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-1872s1c1
Sequence:CCGGCCTGTGCAGAATGCAACTCTTCTCGAGAAGAGTTGCATTCTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-437s1c1
Sequence:CCGGCCCAAACTGAAGCAGGTGTTTCTCGAGAAACACCTGCTTCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-971s1c1
Sequence:CCGGGCACACAAATACTGCGACGAACTCGAGTTCGTCGCAGTATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-1756s1c1
Sequence:CCGGCCGGACTCTCTACAACAACTTCTCGAGAAGTTGTTGTAGAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358370
TRPM1 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-1543s1c1
Sequence:CCGGCGGAGTGAACATGCAGCATTTCTCGAGAAATGCTGCATGTTCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-1872s1c1
Sequence:CCGGCCTGTGCAGAATGCAACTCTTCTCGAGAAGAGTTGCATTCTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-437s1c1
Sequence:CCGGCCCAAACTGAAGCAGGTGTTTCTCGAGAAACACCTGCTTCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-971s1c1
Sequence:CCGGGCACACAAATACTGCGACGAACTCGAGTTCGTCGCAGTATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-1756s1c1
Sequence:CCGGCCGGACTCTCTACAACAACTTCTCGAGAAGTTGTTGTAGAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358370
TRPM1 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-1543s1c1
Sequence:CCGGCGGAGTGAACATGCAGCATTTCTCGAGAAATGCTGCATGTTCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-1872s1c1
Sequence:CCGGCCTGTGCAGAATGCAACTCTTCTCGAGAAGAGTTGCATTCTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-437s1c1
Sequence:CCGGCCCAAACTGAAGCAGGTGTTTCTCGAGAAACACCTGCTTCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-971s1c1
Sequence:CCGGGCACACAAATACTGCGACGAACTCGAGTTCGTCGCAGTATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358370.1-1756s1c1
Sequence:CCGGCCGGACTCTCTACAACAACTTCTCGAGAAGTTGTTGTAGAGAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks