EMAIL THIS PAGE TO A FRIEND

TRPM2

transient receptor potential cation channel, subfamily M, member 2

Synonyms: EREG1 KNP3 LTRPC2 NUDT9H NUDT9L1 TRPC7
UniProtKB ID: O94759, D3DSL6, Q5KTC2, Q6J3P5, Q96KN6, Q96Q93
Gene ID:
Human(7226) Summary: The protein encoded by this gene is a calcium-permeable cation channel that is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
Mouse(28240) transient receptor potential cation channel, subfamily M, member 2
Rat(294329) transient receptor potential cation channel, subfamily M, member 2
Zebrafish(799412) transient receptor potential cation channel, subfamily M, member 2
Horse(100072659) transient receptor potential cation channel, subfamily M, member 2
Horse(100056810) transient receptor potential cation channel, subfamily M, member 2
domestic cat(101090284) transient receptor potential cation channel, subfamily M, member 2
dog(487799) transient receptor potential cation channel, subfamily M, member 2
chicken(424835) transient receptor potential cation channel, subfamily M, member 2
naked mole-rat(101723317) transient receptor potential cation channel, subfamily M, member 2
Domestic Rabbit(100341596) transient receptor potential cation channel, subfamily M, member 2
domestic guinea pig(100720314) transient receptor potential cation channel, subfamily M, member 2
cow(508029) transient receptor potential cation channel, subfamily M, member 2
sheep(101103450) transient receptor potential cation channel, subfamily M, member 2
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003307 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001188 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133821 MISSION® esiRNA esiRNA human TRPM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001188 Rosetta Predictions human pricing
NM_003307 Rosetta Predictions human pricing
NM_001011559 Rosetta Predictions rat pricing
NM_138301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147442 predicted 1510
2 SASI_Hs01_00147443 predicted 1225
3 SASI_Hs01_00147444 predicted 2020
4 SASI_Hs01_00147445 predicted 1487
5 SASI_Hs01_00147446 predicted 1289
6 SASI_Hs01_00147447 predicted 1248
7 SASI_Hs01_00147448 predicted 1500
8 SASI_Hs01_00147449 predicted 1345
9 SASI_Hs01_00147450 predicted 2407
10 SASI_Hs01_00147451 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335404 predicted 1215
2 SASI_Hs02_00335405 predicted 2008
3 SASI_Hs02_00335406 predicted 1478
4 SASI_Hs02_00335407 predicted 1290
5 SASI_Hs02_00335408 predicted 4399
6 SASI_Hs02_00335409 predicted 3045
7 SASI_Hs02_00335410 predicted 1246
8 SASI_Hs02_00335411 predicted 1344
9 SASI_Hs02_00335412 predicted 2404
10 SASI_Hs02_00335413 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042034 predicted 2530
2 SASI_Rn01_00042035 predicted 3544
3 SASI_Rn01_00042036 predicted 1186
4 SASI_Rn01_00042037 predicted 1824
5 SASI_Rn01_00042038 predicted 1399
6 SASI_Rn01_00042039 predicted 2896
7 SASI_Rn01_00042040 predicted 3383
8 SASI_Rn01_00042041 predicted 2938
9 SASI_Rn01_00042043 predicted 4298
10 SASI_Rn02_00199845 predicted 451
11 SASI_Rn01_00042042 predicted 3789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028512 predicted 1632
2 SASI_Mm01_00028514 predicted 3544
3 SASI_Mm01_00028515 predicted 2261
4 SASI_Mm01_00028516 predicted 3057
5 SASI_Mm01_00028517 predicted 3383
6 SASI_Mm01_00028518 predicted 4238
7 SASI_Mm01_00028519 predicted 2488
8 SASI_Mm01_00028520 predicted 4235
9 SASI_Mm01_00028521 predicted 996
10 SASI_Mm02_00339584 predicted 1606
11 SASI_Mm01_00028513 predicted 548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003307
TRPM2 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000044148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-1933s1c1
Sequence:CCGGGCCTGAGTTTGTGAAGCTCTTCTCGAGAAGAGCTTCACAAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-2845s1c1
Sequence:CCGGCCTGAACATCCTCTCCTACTTCTCGAGAAGTAGGAGAGGATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-649s1c1
Sequence:CCGGGAAGAAAGAATGCGTGTATTTCTCGAGAAATACACGCATTCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-4250s1c1
Sequence:CCGGCTGATCTATGACCCACCCTTTCTCGAGAAAGGGTGGGTCATAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003307
TRPM2 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000044148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-1933s1c1
Sequence:CCGGGCCTGAGTTTGTGAAGCTCTTCTCGAGAAGAGCTTCACAAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-2845s1c1
Sequence:CCGGCCTGAACATCCTCTCCTACTTCTCGAGAAGTAGGAGAGGATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-649s1c1
Sequence:CCGGGAAGAAAGAATGCGTGTATTTCTCGAGAAATACACGCATTCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-4250s1c1
Sequence:CCGGCTGATCTATGACCCACCCTTTCTCGAGAAAGGGTGGGTCATAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003307
TRPM2 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000044148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-1933s1c1
Sequence:CCGGGCCTGAGTTTGTGAAGCTCTTCTCGAGAAGAGCTTCACAAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-2845s1c1
Sequence:CCGGCCTGAACATCCTCTCCTACTTCTCGAGAAGTAGGAGAGGATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-649s1c1
Sequence:CCGGGAAGAAAGAATGCGTGTATTTCTCGAGAAATACACGCATTCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003307.1-4250s1c1
Sequence:CCGGCTGATCTATGACCCACCCTTTCTCGAGAAAGGGTGGGTCATAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001188
TRPM2 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-925s1c1
Sequence:CCGGGCTGGAGAAGTTCATATCGGACTCGAGTCCGATATGAACTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001188.2-242s1c1
Sequence:CCGGGAAAGTTCCAAACTGTCTGATCTCGAGATCAGACAGTTTGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001188.2-2779s1c1
Sequence:CCGGGCCCAAGATCATCATTGTGAACTCGAGTTCACAATGATGATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-800s1c1
Sequence:CCGGGAGTACATACTGGATGAGGATCTCGAGATCCTCATCCAGTATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001188.2-163s1c1
Sequence:CCGGCGGCAACAATGACAAGCAAGACTCGAGTCTTGCTTGTCATTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-1883s1c1
Sequence:CCGGGACCTTCTCATTTGGGCCATTCTCGAGAATGGCCCAAATGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-250s1c1
Sequence:CCGGCAAACTGTCTGATGCTGGGAACTCGAGTTCCCAGCATCAGACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001188
TRPM2 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-925s1c1
Sequence:CCGGGCTGGAGAAGTTCATATCGGACTCGAGTCCGATATGAACTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001188.2-242s1c1
Sequence:CCGGGAAAGTTCCAAACTGTCTGATCTCGAGATCAGACAGTTTGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001188.2-2779s1c1
Sequence:CCGGGCCCAAGATCATCATTGTGAACTCGAGTTCACAATGATGATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-800s1c1
Sequence:CCGGGAGTACATACTGGATGAGGATCTCGAGATCCTCATCCAGTATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001188.2-163s1c1
Sequence:CCGGCGGCAACAATGACAAGCAAGACTCGAGTCTTGCTTGTCATTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-1883s1c1
Sequence:CCGGGACCTTCTCATTTGGGCCATTCTCGAGAATGGCCCAAATGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-250s1c1
Sequence:CCGGCAAACTGTCTGATGCTGGGAACTCGAGTTCCCAGCATCAGACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001188
TRPM2 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-925s1c1
Sequence:CCGGGCTGGAGAAGTTCATATCGGACTCGAGTCCGATATGAACTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001188.2-242s1c1
Sequence:CCGGGAAAGTTCCAAACTGTCTGATCTCGAGATCAGACAGTTTGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001188.2-2779s1c1
Sequence:CCGGGCCCAAGATCATCATTGTGAACTCGAGTTCACAATGATGATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-800s1c1
Sequence:CCGGGAGTACATACTGGATGAGGATCTCGAGATCCTCATCCAGTATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001188.2-163s1c1
Sequence:CCGGCGGCAACAATGACAAGCAAGACTCGAGTCTTGCTTGTCATTGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-1883s1c1
Sequence:CCGGGACCTTCTCATTTGGGCCATTCTCGAGAATGGCCCAAATGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001188.2-250s1c1
Sequence:CCGGCAAACTGTCTGATGCTGGGAACTCGAGTTCCCAGCATCAGACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138301
TRPM2 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-3202s1c1
Sequence:CCGGGCCCAAGATAATCATCGTGAACTCGAGTTCACGATGATTATCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-621s1c1
Sequence:CCGGGCTCATGGATTCCCGAGAATACTCGAGTATTCTCGGGAATCCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-4235s1c1
Sequence:CCGGGCAGAGTTTCTGATCTACGATCTCGAGATCGTAGATCAGAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-2311s1c1
Sequence:CCGGCCTTCTCATTTGGGCCGTTATCTCGAGATAACGGCCCAAATGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-1453s1c1
Sequence:CCGGGCATACAATCTACAATGCCATCTCGAGATGGCATTGTAGATTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138301
TRPM2 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-3202s1c1
Sequence:CCGGGCCCAAGATAATCATCGTGAACTCGAGTTCACGATGATTATCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-621s1c1
Sequence:CCGGGCTCATGGATTCCCGAGAATACTCGAGTATTCTCGGGAATCCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-4235s1c1
Sequence:CCGGGCAGAGTTTCTGATCTACGATCTCGAGATCGTAGATCAGAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-2311s1c1
Sequence:CCGGCCTTCTCATTTGGGCCGTTATCTCGAGATAACGGCCCAAATGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-1453s1c1
Sequence:CCGGGCATACAATCTACAATGCCATCTCGAGATGGCATTGTAGATTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138301
TRPM2 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-3202s1c1
Sequence:CCGGGCCCAAGATAATCATCGTGAACTCGAGTTCACGATGATTATCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-621s1c1
Sequence:CCGGGCTCATGGATTCCCGAGAATACTCGAGTATTCTCGGGAATCCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-4235s1c1
Sequence:CCGGGCAGAGTTTCTGATCTACGATCTCGAGATCGTAGATCAGAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-2311s1c1
Sequence:CCGGCCTTCTCATTTGGGCCGTTATCTCGAGATAACGGCCCAAATGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138301.1-1453s1c1
Sequence:CCGGGCATACAATCTACAATGCCATCTCGAGATGGCATTGTAGATTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks