EMAIL THIS PAGE TO A FRIEND

TRPM3

transient receptor potential cation channel, subfamily M, member 3

Synonyms: GON-2 LTRPC3 MLSN2
Gene ID:
Human(80036) Summary: The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(226025) transient receptor potential cation channel, subfamily M, member 3
Rat(309407) transient receptor potential cation channel, subfamily M, member 3
cow(100337068) transient receptor potential cation channel, subfamily M, member 3
cow(540699) transient receptor potential cation channel, subfamily M, member 3
sheep(101103123) transient receptor potential cation channel, subfamily M, member 3
domestic guinea pig(100725483) transient receptor potential cation channel, subfamily M, member 3
Domestic Rabbit(100342001) transient receptor potential cation channel, subfamily M, member 3
naked mole-rat(101714096) transient receptor potential cation channel, subfamily M, member 3
Zebrafish(565807) transient receptor potential cation channel, subfamily M, member 3
chicken(427249) transient receptor potential cation channel, subfamily M, member 3
dog(476326) transient receptor potential cation channel, subfamily M, member 3
Horse(100050231) transient receptor potential cation channel, subfamily M, member 3
domestic cat(101086683) transient receptor potential cation channel, subfamily M, member 3
344 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301629 Anti-TRPM3 affinity isolated antibody human
immunohistochemistry pricing
AV35609 Anti-TRPM3 (AB3) antibody produced in rabbit IgG fraction of antiserum canine, rabbit, bovine, zebrafish, guinea pig, rat, human, mouse, horse
western blot pricing
SAB1303767 ANTI-TRPM3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB2106400 Anti-TRPM3 antibody produced in rabbit affinity isolated antibody human, mouse, horse, guinea pig, rabbit
ELISA, western blot pricing
SAB2106401 Anti-TRPM3 antibody produced in rabbit affinity isolated antibody mouse, rabbit, zebrafish, bovine, guinea pig, horse, human, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177341 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177341 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177341 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080561 MISSION® esiRNA esiRNA human TRPM3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007470 Rosetta Predictions human pricing
NM_001007471 Rosetta Predictions human pricing
NM_020952 Rosetta Predictions human pricing
NM_024971 Rosetta Predictions human pricing
NM_206944 Rosetta Predictions human pricing
NM_206945 Rosetta Predictions human pricing
NM_206946 Rosetta Predictions human pricing
NM_206947 Rosetta Predictions human pricing
NM_206948 Rosetta Predictions human pricing
XM_001079904 Rosetta Predictions rat pricing
XM_219902 Rosetta Predictions rat pricing
NM_001035239 Rosetta Predictions mouse pricing
NM_001035240 Rosetta Predictions mouse pricing
NM_001035241 Rosetta Predictions mouse pricing
NM_001035242 Rosetta Predictions mouse pricing
NM_001035243 Rosetta Predictions mouse pricing
NM_001035244 Rosetta Predictions mouse pricing
NM_001035245 Rosetta Predictions mouse pricing
NM_001035246 Rosetta Predictions mouse pricing
NM_177341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144558 predicted 623
2 SASI_Hs01_00144560 predicted 526
3 SASI_Hs01_00144561 predicted 611
4 SASI_Hs02_00305314 predicted 612
5 SASI_Hs01_00144562 predicted 416
6 SASI_Hs02_00305315 predicted 431
7 SASI_Hs01_00144564 predicted 466
8 SASI_Hs01_00144565 predicted 416
9 SASI_Hs01_00144566 predicted 591
10 SASI_Hs01_00144567 predicted 599
11 SASI_Hs01_00144559 predicted 517
12 SASI_Hs01_00144563 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191825 predicted 880
2 SASI_Hs01_00191826 predicted 955
3 SASI_Hs01_00191827 predicted 682
4 SASI_Hs01_00191828 predicted 696
5 SASI_Hs02_00305316 predicted 776
6 SASI_Hs01_00191829 predicted 693
7 SASI_Hs02_00305317 predicted 924
8 SASI_Hs01_00191831 predicted 809
9 SASI_Hs01_00191832 predicted 765
10 SASI_Hs01_00191833 predicted 941
11 SASI_Hs01_00191824 predicted 864
12 SASI_Hs01_00191830 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074713 predicted 623
2 SASI_Hs01_00074715 predicted 528
3 SASI_Hs01_00074716 predicted 609
4 SASI_Hs02_00354378 predicted 606
5 SASI_Hs01_00074717 predicted 413
6 SASI_Hs02_00354379 predicted 425
7 SASI_Hs01_00074719 predicted 466
8 SASI_Hs01_00074720 predicted 422
9 SASI_Hs01_00074721 predicted 592
10 SASI_Hs01_00074722 predicted 600
11 SASI_Hs01_00074714 predicted 513
12 SASI_Hs01_00074718 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045074 predicted 617
2 SASI_Hs01_00045076 predicted 528
3 SASI_Hs01_00045077 predicted 604
4 SASI_Hs02_00357635 predicted 610
5 SASI_Hs01_00045078 predicted 411
6 SASI_Hs02_00357636 predicted 425
7 SASI_Hs01_00045080 predicted 467
8 SASI_Hs01_00045081 predicted 423
9 SASI_Hs01_00045082 predicted 588
10 SASI_Hs01_00045083 predicted 597
11 SASI_Hs01_00045075 predicted 513
12 SASI_Hs01_00045079 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014020 predicted 619
2 SASI_Hs01_00014022 predicted 527
3 SASI_Hs01_00014023 predicted 609
4 SASI_Hs02_00373645 predicted 607
5 SASI_Hs01_00014024 predicted 414
6 SASI_Hs02_00373646 predicted 428
7 SASI_Hs01_00014026 predicted 463
8 SASI_Hs01_00014027 predicted 421
9 SASI_Hs01_00014028 predicted 595
10 SASI_Hs01_00014029 predicted 601
11 SASI_Hs01_00014021 predicted 510
12 SASI_Hs01_00014025 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083415 predicted 620
2 SASI_Hs01_00083417 predicted 529
3 SASI_Hs01_00083418 predicted 609
4 SASI_Hs02_00373647 predicted 612
5 SASI_Hs01_00083419 predicted 412
6 SASI_Hs02_00373648 predicted 431
7 SASI_Hs01_00083421 predicted 465
8 SASI_Hs01_00083422 predicted 419
9 SASI_Hs01_00083423 predicted 593
10 SASI_Hs01_00083424 predicted 599
11 SASI_Hs01_00083416 predicted 512
12 SASI_Hs01_00083420 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201337 predicted 624
2 SASI_Hs01_00201339 predicted 528
3 SASI_Hs01_00201340 predicted 605
4 SASI_Hs02_00373649 predicted 603
5 SASI_Hs01_00201341 predicted 416
6 SASI_Hs02_00373650 predicted 433
7 SASI_Hs01_00201343 predicted 461
8 SASI_Hs01_00201344 predicted 418
9 SASI_Hs01_00201345 predicted 596
10 SASI_Hs01_00201346 predicted 595
11 SASI_Hs01_00201338 predicted 517
12 SASI_Hs01_00201342 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078482 predicted 625
2 SASI_Hs01_00078484 predicted 530
3 SASI_Hs01_00078485 predicted 603
4 SASI_Hs02_00373651 predicted 607
5 SASI_Hs01_00078486 predicted 420
6 SASI_Hs02_00373652 predicted 430
7 SASI_Hs01_00078488 predicted 463
8 SASI_Hs01_00078489 predicted 419
9 SASI_Hs01_00078490 predicted 589
10 SASI_Hs01_00078491 predicted 597
11 SASI_Hs01_00078483 predicted 517
12 SASI_Hs01_00078487 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204391 predicted 620
2 SASI_Hs01_00204393 predicted 530
3 SASI_Hs01_00204394 predicted 605
4 SASI_Hs02_00373653 predicted 607
5 SASI_Hs01_00204395 predicted 415
6 SASI_Hs02_00373654 predicted 431
7 SASI_Hs01_00204397 predicted 464
8 SASI_Hs01_00204398 predicted 420
9 SASI_Hs01_00204399 predicted 591
10 SASI_Hs01_00204400 predicted 598
11 SASI_Hs01_00204392 predicted 511
12 SASI_Hs01_00204396 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365934 predicted 1790
2 SASI_Rn02_00365935 predicted 3861
3 SASI_Rn02_00365936 predicted 3949
4 SASI_Rn02_00365937 predicted 1957
5 SASI_Rn02_00365938 predicted 3269
6 SASI_Rn02_00365939 predicted 3238
7 SASI_Rn02_00365940 predicted 4381
8 SASI_Rn02_00365941 predicted 3751
9 SASI_Rn02_00365942 predicted 1893
10 SASI_Rn02_00365943 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378829 predicted 1786
2 SASI_Rn02_00378830 predicted 3859
3 SASI_Rn02_00378831 predicted 3945
4 SASI_Rn02_00378832 predicted 1950
5 SASI_Rn02_00378833 predicted 3273
6 SASI_Rn02_00378834 predicted 3236
7 SASI_Rn02_00378835 predicted 4388
8 SASI_Rn02_00378836 predicted 3751
9 SASI_Rn02_00378837 predicted 1897
10 SASI_Rn02_00378838 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190579 predicted 717
2 SASI_Mm01_00190580 predicted 717
3 SASI_Mm01_00190581 predicted 449
4 SASI_Mm01_00190582 predicted 496
5 SASI_Mm01_00190583 predicted 457
6 SASI_Mm01_00190584 predicted 639
7 SASI_Mm01_00190586 predicted 687
8 SASI_Mm01_00190587 predicted 735
9 SASI_Mm01_00190588 predicted 585
10 SASI_Mm02_00289258 predicted 545
11 SASI_Mm01_00190585 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183071 predicted 719
2 SASI_Mm01_00183072 predicted 720
3 SASI_Mm01_00183073 predicted 450
4 SASI_Mm01_00183074 predicted 492
5 SASI_Mm01_00183075 predicted 455
6 SASI_Mm01_00183076 predicted 643
7 SASI_Mm01_00183078 predicted 682
8 SASI_Mm01_00183079 predicted 735
9 SASI_Mm01_00183080 predicted 578
10 SASI_Mm02_00289259 predicted 542
11 SASI_Mm01_00183077 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134698 predicted 714
2 SASI_Mm01_00134699 predicted 720
3 SASI_Mm01_00134700 predicted 450
4 SASI_Mm01_00134701 predicted 494
5 SASI_Mm01_00134702 predicted 459
6 SASI_Mm01_00134703 predicted 636
7 SASI_Mm01_00134705 predicted 684
8 SASI_Mm01_00134706 predicted 738
9 SASI_Mm01_00134707 predicted 584
10 SASI_Mm02_00289260 predicted 537
11 SASI_Mm01_00134704 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094402 predicted 714
2 SASI_Mm01_00094403 predicted 720
3 SASI_Mm01_00094404 predicted 450
4 SASI_Mm01_00094405 predicted 497
5 SASI_Mm01_00094406 predicted 463
6 SASI_Mm01_00094407 predicted 644
7 SASI_Mm01_00094409 predicted 680
8 SASI_Mm01_00094410 predicted 734
9 SASI_Mm01_00094411 predicted 584
10 SASI_Mm02_00289261 predicted 545
11 SASI_Mm01_00094408 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157717 predicted 718
2 SASI_Mm01_00157718 predicted 722
3 SASI_Mm01_00157719 predicted 443
4 SASI_Mm01_00157720 predicted 489
5 SASI_Mm01_00157721 predicted 460
6 SASI_Mm01_00157722 predicted 636
7 SASI_Mm01_00157724 predicted 687
8 SASI_Mm01_00157725 predicted 733
9 SASI_Mm01_00157726 predicted 580
10 SASI_Mm02_00289262 predicted 538
11 SASI_Mm01_00157723 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118332 predicted 763
2 SASI_Mm01_00118333 predicted 762
3 SASI_Mm01_00118334 predicted 783
4 SASI_Mm01_00118335 predicted 541
5 SASI_Mm01_00118336 predicted 685
6 SASI_Mm01_00118337 predicted 567
7 SASI_Mm01_00118338 predicted 729
8 SASI_Mm01_00118339 predicted 756
9 SASI_Mm01_00118340 predicted 778
10 SASI_Mm02_00289263 predicted 631
11 SASI_Mm01_00118341 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081370 predicted 765
2 SASI_Mm01_00081371 predicted 761
3 SASI_Mm01_00081372 predicted 776
4 SASI_Mm01_00081373 predicted 538
5 SASI_Mm01_00081374 predicted 692
6 SASI_Mm01_00081375 predicted 566
7 SASI_Mm01_00081376 predicted 727
8 SASI_Mm01_00081377 predicted 763
9 SASI_Mm01_00081378 predicted 780
10 SASI_Mm02_00289264 predicted 629
11 SASI_Mm01_00081379 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039318 predicted 770
2 SASI_Mm01_00039319 predicted 764
3 SASI_Mm01_00039320 predicted 784
4 SASI_Mm01_00039321 predicted 541
5 SASI_Mm01_00039322 predicted 690
6 SASI_Mm01_00039323 predicted 566
7 SASI_Mm01_00039324 predicted 727
8 SASI_Mm01_00039325 predicted 755
9 SASI_Mm01_00039326 predicted 785
10 SASI_Mm02_00289265 predicted 635
11 SASI_Mm01_00039327 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043795 predicted 782
2 SASI_Mm01_00043796 predicted 783
3 SASI_Mm01_00043797 predicted 508
4 SASI_Mm01_00043798 predicted 557
5 SASI_Mm01_00043799 predicted 529
6 SASI_Mm01_00043800 predicted 710
7 SASI_Mm01_00043802 predicted 749
8 SASI_Mm01_00043803 predicted 803
9 SASI_Mm01_00043804 predicted 649
10 SASI_Mm02_00347470 predicted 604
11 SASI_Mm01_00043801 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206948
TRPM3 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-595s1c1
Sequence:CCGGCGAGGAAAGATATGCACCATACTCGAGTATGGTGCATATCTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-889s1c1
Sequence:CCGGCCCAATGTGATCTCGATTGTTCTCGAGAACAATCGAGATCACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-813s1c1
Sequence:CCGGGCATATTTCACTCCAGAAGATCTCGAGATCTTCTGGAGTGAAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-378s1c1
Sequence:CCGGGATGACCAAGGAATGGCAGTTCTCGAGAACTGCCATTCCTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-483s1c1
Sequence:CCGGAGGGCTCATCAAAGCAGCAATCTCGAGATTGCTGCTTTGATGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-756s21c1
Sequence:CCGGGCATGCATTCCCACTTCATTCCTCGAGGAATGAAGTGGGAATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-591s21c1
Sequence:CCGGGCGATGCCTTGAAGGATCATGCTCGAGCATGATCCTTCAAGGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-885s21c1
Sequence:CCGGTTCCTGTGGTGGCACTCATAGCTCGAGCTATGAGTGCCACCACAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206948.2-1095s21c1
Sequence:CCGCCGAGGGTATGAGTGGATTATGCTCGAGCATAATCCACTCATACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-1037s21c1
Sequence:CCGGGAAGGCGGGTAGGTAACTTTCCTCGAGGAAAGTTACCTACCCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206948
TRPM3 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-595s1c1
Sequence:CCGGCGAGGAAAGATATGCACCATACTCGAGTATGGTGCATATCTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-889s1c1
Sequence:CCGGCCCAATGTGATCTCGATTGTTCTCGAGAACAATCGAGATCACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-813s1c1
Sequence:CCGGGCATATTTCACTCCAGAAGATCTCGAGATCTTCTGGAGTGAAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-378s1c1
Sequence:CCGGGATGACCAAGGAATGGCAGTTCTCGAGAACTGCCATTCCTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-483s1c1
Sequence:CCGGAGGGCTCATCAAAGCAGCAATCTCGAGATTGCTGCTTTGATGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-756s21c1
Sequence:CCGGGCATGCATTCCCACTTCATTCCTCGAGGAATGAAGTGGGAATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-591s21c1
Sequence:CCGGGCGATGCCTTGAAGGATCATGCTCGAGCATGATCCTTCAAGGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-885s21c1
Sequence:CCGGTTCCTGTGGTGGCACTCATAGCTCGAGCTATGAGTGCCACCACAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206948.2-1095s21c1
Sequence:CCGCCGAGGGTATGAGTGGATTATGCTCGAGCATAATCCACTCATACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-1037s21c1
Sequence:CCGGGAAGGCGGGTAGGTAACTTTCCTCGAGGAAAGTTACCTACCCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206948
TRPM3 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-595s1c1
Sequence:CCGGCGAGGAAAGATATGCACCATACTCGAGTATGGTGCATATCTTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-889s1c1
Sequence:CCGGCCCAATGTGATCTCGATTGTTCTCGAGAACAATCGAGATCACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-813s1c1
Sequence:CCGGGCATATTTCACTCCAGAAGATCTCGAGATCTTCTGGAGTGAAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-378s1c1
Sequence:CCGGGATGACCAAGGAATGGCAGTTCTCGAGAACTGCCATTCCTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206948.1-483s1c1
Sequence:CCGGAGGGCTCATCAAAGCAGCAATCTCGAGATTGCTGCTTTGATGAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-756s21c1
Sequence:CCGGGCATGCATTCCCACTTCATTCCTCGAGGAATGAAGTGGGAATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-591s21c1
Sequence:CCGGGCGATGCCTTGAAGGATCATGCTCGAGCATGATCCTTCAAGGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-885s21c1
Sequence:CCGGTTCCTGTGGTGGCACTCATAGCTCGAGCTATGAGTGCCACCACAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206948.2-1095s21c1
Sequence:CCGCCGAGGGTATGAGTGGATTATGCTCGAGCATAATCCACTCATACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206948.2-1037s21c1
Sequence:CCGGGAAGGCGGGTAGGTAACTTTCCTCGAGGAAAGTTACCTACCCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177341
TRPM3 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177341.3-4637s1c1
Sequence:CCGGCCGCTCATCATGTGACCATTTCTCGAGAAATGGTCACATGATGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-3439s1c1
Sequence:CCGGGCCGTCTTCAACAATACATTTCTCGAGAAATGTATTGTTGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-2427s1c1
Sequence:CCGGCCTCAAGGTAATTCTGGGAATCTCGAGATTCCCAGAATTACCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-3736s1c1
Sequence:CCGGCGCTTCAATTCGTCCAACGATCTCGAGATCGTTGGACGAATTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-1188s1c1
Sequence:CCGGCCTGGCATTTGGGCATAAATACTCGAGTATTTATGCCCAAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177341
TRPM3 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177341.3-4637s1c1
Sequence:CCGGCCGCTCATCATGTGACCATTTCTCGAGAAATGGTCACATGATGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-3439s1c1
Sequence:CCGGGCCGTCTTCAACAATACATTTCTCGAGAAATGTATTGTTGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-2427s1c1
Sequence:CCGGCCTCAAGGTAATTCTGGGAATCTCGAGATTCCCAGAATTACCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-3736s1c1
Sequence:CCGGCGCTTCAATTCGTCCAACGATCTCGAGATCGTTGGACGAATTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-1188s1c1
Sequence:CCGGCCTGGCATTTGGGCATAAATACTCGAGTATTTATGCCCAAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177341
TRPM3 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177341.3-4637s1c1
Sequence:CCGGCCGCTCATCATGTGACCATTTCTCGAGAAATGGTCACATGATGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-3439s1c1
Sequence:CCGGGCCGTCTTCAACAATACATTTCTCGAGAAATGTATTGTTGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-2427s1c1
Sequence:CCGGCCTCAAGGTAATTCTGGGAATCTCGAGATTCCCAGAATTACCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-3736s1c1
Sequence:CCGGCGCTTCAATTCGTCCAACGATCTCGAGATCGTTGGACGAATTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177341.3-1188s1c1
Sequence:CCGGCCTGGCATTTGGGCATAAATACTCGAGTATTTATGCCCAAATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks