EMAIL THIS PAGE TO A FRIEND

TRPM4

transient receptor potential cation channel, subfamily M, member 4

Synonyms: PFHB1B TRPM4B
UniProtKB ID: Q8TD43, A2RU25, Q7Z5D9, Q96L84, Q9NXV1
Gene ID:
Human(54795) Summary: The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
Mouse(68667) transient receptor potential cation channel, subfamily M, member 4
Rat(171143) transient receptor potential cation channel, subfamily M, member 4
Zebrafish(100004946) transient receptor potential cation channel, subfamily M, member 4
domestic cat(101083051) transient receptor potential cation channel, subfamily M, member 4
dog(484385) transient receptor potential cation channel, subfamily M, member 4
naked mole-rat(101707093) transient receptor potential cation channel, subfamily M, member 4
domestic guinea pig(100726173) transient receptor potential cation channel, subfamily M, member 4
cow(100295930) transient receptor potential cation channel, subfamily M, member 4
sheep(101110084) transient receptor potential cation channel, subfamily M, member 4
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017636 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017636 Rosetta Predictions human pricing
XM_001076671 Rosetta Predictions rat pricing
XM_001080721 Rosetta Predictions rat pricing
XM_574447 Rosetta Predictions rat pricing
NM_175130 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350320 predicted 2790
2 SASI_Hs01_00215327 predicted 1782
3 SASI_Hs01_00215328 predicted 1061
4 SASI_Hs01_00215329 predicted 3566
5 SASI_Hs01_00215331 predicted 1840
6 SASI_Hs01_00215333 predicted 1181
7 SASI_Hs01_00215334 predicted 3551
8 SASI_Hs01_00215335 predicted 3503
9 SASI_Hs01_00215336 predicted 2242
10 SASI_Hs02_00350321 predicted 763
11 SASI_Hs01_00215330 predicted 3406
12 SASI_Hs01_00215332 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354080 predicted 309
2 SASI_Rn02_00354081 predicted 271
3 SASI_Rn02_00354082 predicted 336
4 SASI_Rn02_00354083 predicted 198
5 SASI_Rn02_00354084 predicted 311
6 SASI_Rn02_00354085 predicted 310
7 SASI_Rn02_00354086 predicted 309
8 SASI_Rn02_00354087 predicted 308
9 SASI_Rn02_00354088 predicted 339
10 SASI_Rn02_00354089 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369048 predicted 3782
2 SASI_Rn02_00369049 predicted 1193
3 SASI_Rn02_00369050 predicted 2836
4 SASI_Rn02_00369051 predicted 1149
5 SASI_Rn02_00369052 predicted 1397
6 SASI_Rn02_00369053 predicted 1385
7 SASI_Rn02_00369054 predicted 1077
8 SASI_Rn02_00369055 predicted 2717
9 SASI_Rn02_00369056 predicted 760
10 SASI_Rn02_00369057 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402031 predicted 3739
2 SASI_Rn02_00402032 predicted 3748
3 SASI_Rn02_00402033 predicted 3726
4 SASI_Rn02_00402034 predicted 3969
5 SASI_Rn02_00402035 predicted 3844
6 SASI_Rn02_00402036 predicted 3853
7 SASI_Rn02_00402037 predicted 3845
8 SASI_Rn02_00402038 predicted 3968
9 SASI_Rn02_00402039 predicted 3837
10 SASI_Rn02_00402040 predicted 3755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345745 predicted 3710
2 SASI_Mm01_00086852 predicted 2180
3 SASI_Mm01_00086853 predicted 1184
4 SASI_Mm01_00086854 predicted 1676
5 SASI_Mm01_00086855 predicted 910
6 SASI_Mm02_00345746 predicted 3536
7 SASI_Mm01_00086857 predicted 3144
8 SASI_Mm01_00086858 predicted 1125
9 SASI_Mm01_00086860 predicted 3498
10 SASI_Mm01_00086861 predicted 1705
11 SASI_Mm01_00086856 predicted 1906
12 SASI_Mm01_00086859 predicted 1835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017636
TRPM4 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017636.2-1389s21c1
Sequence:CCGGGTTCGTGCGCTTGCTCATTTCCTCGAGGAAATGAGCAAGCGCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017636.2-363s21c1
Sequence:CCGGGGATCCAGCTGCAGTTTATAGCTCGAGCTATAAACTGCAGCTGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-2517s1c1
Sequence:CCGGGCTGCTCTATTTCTGGGCTTTCTCGAGAAAGCCCAGAAATAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-916s1c1
Sequence:CCGGGAGAAGATGTTGACGCGAATACTCGAGTATTCGCGTCAACATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-2234s1c1
Sequence:CCGGAGCTAGAGTTTGACATGGATACTCGAGTATCCATGTCAAACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-900s1c1
Sequence:CCGGCCTGATTGATGGTGATGAGAACTCGAGTTCTCATCACCATCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-3400s1c1
Sequence:CCGGCGGGTTTACCTTTCTAAGGAACTCGAGTTCCTTAGAAAGGTAAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017636
TRPM4 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017636.2-1389s21c1
Sequence:CCGGGTTCGTGCGCTTGCTCATTTCCTCGAGGAAATGAGCAAGCGCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017636.2-363s21c1
Sequence:CCGGGGATCCAGCTGCAGTTTATAGCTCGAGCTATAAACTGCAGCTGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-2517s1c1
Sequence:CCGGGCTGCTCTATTTCTGGGCTTTCTCGAGAAAGCCCAGAAATAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-916s1c1
Sequence:CCGGGAGAAGATGTTGACGCGAATACTCGAGTATTCGCGTCAACATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-2234s1c1
Sequence:CCGGAGCTAGAGTTTGACATGGATACTCGAGTATCCATGTCAAACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-900s1c1
Sequence:CCGGCCTGATTGATGGTGATGAGAACTCGAGTTCTCATCACCATCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-3400s1c1
Sequence:CCGGCGGGTTTACCTTTCTAAGGAACTCGAGTTCCTTAGAAAGGTAAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017636
TRPM4 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017636.2-1389s21c1
Sequence:CCGGGTTCGTGCGCTTGCTCATTTCCTCGAGGAAATGAGCAAGCGCACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017636.2-363s21c1
Sequence:CCGGGGATCCAGCTGCAGTTTATAGCTCGAGCTATAAACTGCAGCTGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-2517s1c1
Sequence:CCGGGCTGCTCTATTTCTGGGCTTTCTCGAGAAAGCCCAGAAATAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-916s1c1
Sequence:CCGGGAGAAGATGTTGACGCGAATACTCGAGTATTCGCGTCAACATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-2234s1c1
Sequence:CCGGAGCTAGAGTTTGACATGGATACTCGAGTATCCATGTCAAACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-900s1c1
Sequence:CCGGCCTGATTGATGGTGATGAGAACTCGAGTTCTCATCACCATCAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017636.2-3400s1c1
Sequence:CCGGCGGGTTTACCTTTCTAAGGAACTCGAGTTCCTTAGAAAGGTAAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175130
TRPM4 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-2014s1c1
Sequence:CCGGCCTGGGTAATGTGGTCAGTTACTCGAGTAACTGACCACATTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-524s1c1
Sequence:CCGGGAGAAGATGTTAAAGCGGATACTCGAGTATCCGCTTTAACATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-1360s1c1
Sequence:CCGGCCTGCTTATTTGGGCTCTGTTCTCGAGAACAGAGCCCAAATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-1085s1c1
Sequence:CCGGCCTAACTCACTGATCCGAAATCTCGAGATTTCGGATCAGTGAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-2386s1c1
Sequence:CCGGGCACATCTTCACGGTGAACAACTCGAGTTGTTCACCGTGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175130
TRPM4 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-2014s1c1
Sequence:CCGGCCTGGGTAATGTGGTCAGTTACTCGAGTAACTGACCACATTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-524s1c1
Sequence:CCGGGAGAAGATGTTAAAGCGGATACTCGAGTATCCGCTTTAACATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-1360s1c1
Sequence:CCGGCCTGCTTATTTGGGCTCTGTTCTCGAGAACAGAGCCCAAATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-1085s1c1
Sequence:CCGGCCTAACTCACTGATCCGAAATCTCGAGATTTCGGATCAGTGAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-2386s1c1
Sequence:CCGGGCACATCTTCACGGTGAACAACTCGAGTTGTTCACCGTGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175130
TRPM4 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-2014s1c1
Sequence:CCGGCCTGGGTAATGTGGTCAGTTACTCGAGTAACTGACCACATTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-524s1c1
Sequence:CCGGGAGAAGATGTTAAAGCGGATACTCGAGTATCCGCTTTAACATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-1360s1c1
Sequence:CCGGCCTGCTTATTTGGGCTCTGTTCTCGAGAACAGAGCCCAAATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-1085s1c1
Sequence:CCGGCCTAACTCACTGATCCGAAATCTCGAGATTTCGGATCAGTGAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175130.2-2386s1c1
Sequence:CCGGGCACATCTTCACGGTGAACAACTCGAGTTGTTCACCGTGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks