EMAIL THIS PAGE TO A FRIEND

TRPM5

transient receptor potential cation channel, subfamily M, member 5

Synonyms: LTRPC5 MTR1
UniProtKB ID: Q9NZQ8, A6NHS0, Q52LU2, Q9NY34
Gene ID:
Human(29850) Summary: This gene encodes a member of the transient receptor potential (TRP) protein family, which is a diverse group of proteins with structural features typical of ion channels. This protein plays an important role in taste transduction, and has characteristics of a calcium-activated, non-selective cation channel that carries Na+, K+, and Cs+ ions equally well, but not Ca(2+) ions. It is activated by lower concentrations of intracellular Ca(2+), and inhibited by higher concentrations. It is also a highly temperature-sensitive, heat activated channel showing a steep increase of inward currents at temperatures between 15 and 35 degrees Celsius. This gene is located within the Beckwith-Wiedemann syndrome critical region-1 on chromosome 11p15.5, and has been shown to be imprinted, with exclusive expression from the paternal allele. [provided by RefSeq, Oct 2010]
Mouse(56843) transient receptor potential cation channel, subfamily M, member 5
Rat(365391) transient receptor potential cation channel, subfamily M, member 5
Zebrafish(557722) transient receptor potential cation channel, subfamily M, member 5
domestic cat(101092891) transient receptor potential cation channel, subfamily M, member 5
dog(483668) transient receptor potential cation channel, subfamily M, member 5
chicken(423091) transient receptor potential cation channel, subfamily M, member 5
cow(100299596) transient receptor potential cation channel, subfamily M, member 5
sheep(101119861) transient receptor potential cation channel, subfamily M, member 5
domestic guinea pig(100720335) transient receptor potential cation channel, subfamily M, member 5
naked mole-rat(101709030) transient receptor potential cation channel, subfamily M, member 5
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014555 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012291 MISSION® esiRNA esiRNA targeting human TRPM5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014555 Rosetta Predictions human pricing
XM_001065110 Rosetta Predictions rat pricing
XM_344979 Rosetta Predictions rat pricing
NM_020277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152199 predicted 3304
2 SASI_Hs01_00152201 predicted 1039
3 SASI_Hs01_00152203 predicted 2989
4 SASI_Hs01_00152204 predicted 2435
5 SASI_Hs02_00345822 predicted 2549
6 SASI_Hs01_00152205 predicted 2557
7 SASI_Hs01_00152206 predicted 3498
8 SASI_Hs01_00152207 predicted 2971
9 SASI_Hs01_00152208 predicted 2773
10 SASI_Hs02_00345823 predicted 873
11 SASI_Hs01_00152200 predicted 1185
12 SASI_Hs01_00152202 predicted 2323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312892 predicted 3384
2 SASI_Rn02_00312893 predicted 1272
3 SASI_Rn02_00312894 predicted 1132
4 SASI_Rn02_00312895 predicted 2832
5 SASI_Rn02_00312896 predicted 2973
6 SASI_Rn02_00312897 predicted 1955
7 SASI_Rn02_00312898 predicted 942
8 SASI_Rn02_00312899 predicted 1305
9 SASI_Rn02_00312900 predicted 2489
10 SASI_Rn02_00312901 predicted 3046
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397821 predicted 4016
2 SASI_Rn02_00397822 predicted 3859
3 SASI_Rn02_00397823 predicted 3894
4 SASI_Rn02_00397824 predicted 3697
5 SASI_Rn02_00397825 predicted 3963
6 SASI_Rn02_00397826 predicted 3544
7 SASI_Rn02_00397827 predicted 3808
8 SASI_Rn02_00397828 predicted 3672
9 SASI_Rn02_00397829 predicted 3979
10 SASI_Rn02_00397830 predicted 3840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090719 predicted 3401
2 SASI_Mm01_00090720 predicted 1271
3 SASI_Mm01_00090721 predicted 3386
4 SASI_Mm01_00090722 predicted 2840
5 SASI_Mm01_00090723 predicted 2972
6 SASI_Mm01_00090725 predicted 1300
7 SASI_Mm01_00090726 predicted 1212
8 SASI_Mm02_00325478 predicted 3050
9 SASI_Mm01_00090727 predicted 2662
10 SASI_Mm01_00090728 predicted 3475
11 SASI_Mm01_00090724 predicted 3377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020277
TRPM5 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020277.1-3472s1c1
Sequence:CCGGCCTGAAATGGAGAAACCACTTCTCGAGAAGTGGTTTCTCCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-668s1c1
Sequence:CCGGGCATCCAGATACCTGTCCTTTCTCGAGAAAGGACAGGTATCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-1971s1c1
Sequence:CCGGCCTCATCTACACAAACCTCATCTCGAGATGAGGTTTGTGTAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-2782s1c1
Sequence:CCGGGCTCGTGTGAACTGTTCTCTTCTCGAGAAGAGAACAGTTCACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-1648s1c1
Sequence:CCGGGCCTGCAAGATCATAAAGGAACTCGAGTTCCTTTATGATCTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020277
TRPM5 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020277.1-3472s1c1
Sequence:CCGGCCTGAAATGGAGAAACCACTTCTCGAGAAGTGGTTTCTCCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-668s1c1
Sequence:CCGGGCATCCAGATACCTGTCCTTTCTCGAGAAAGGACAGGTATCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-1971s1c1
Sequence:CCGGCCTCATCTACACAAACCTCATCTCGAGATGAGGTTTGTGTAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-2782s1c1
Sequence:CCGGGCTCGTGTGAACTGTTCTCTTCTCGAGAAGAGAACAGTTCACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-1648s1c1
Sequence:CCGGGCCTGCAAGATCATAAAGGAACTCGAGTTCCTTTATGATCTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020277
TRPM5 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020277.1-3472s1c1
Sequence:CCGGCCTGAAATGGAGAAACCACTTCTCGAGAAGTGGTTTCTCCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-668s1c1
Sequence:CCGGGCATCCAGATACCTGTCCTTTCTCGAGAAAGGACAGGTATCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-1971s1c1
Sequence:CCGGCCTCATCTACACAAACCTCATCTCGAGATGAGGTTTGTGTAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-2782s1c1
Sequence:CCGGGCTCGTGTGAACTGTTCTCTTCTCGAGAAGAGAACAGTTCACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020277.1-1648s1c1
Sequence:CCGGGCCTGCAAGATCATAAAGGAACTCGAGTTCCTTTATGATCTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014555
TRPM5 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-2395s1c1
Sequence:CCGGGTGAAGAAGTTCACACTGTATCTCGAGATACAGTGTGAACTTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-2554s1c1
Sequence:CCGGCTGATCCATATCTTTGCCATACTCGAGTATGGCAAAGATATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-1983s1c1
Sequence:CCGGCCTCGTCTATACCAACCTCATCTCGAGATGAGGTTGGTATAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-876s1c1
Sequence:CCGGGCATTTCTCTTGGGAGGACATCTCGAGATGTCCTCCCAAGAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-2318s1c1
Sequence:CCGGCCCTCTACTTCTGGGTCTTTACTCGAGTAAAGACCCAGAAGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014555.3-2598s21c1
Sequence:CCGGCATCGTGGTAGAGCGCATGATCTCGAGATCATGCGCTCTACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014555.3-3559s21c1
Sequence:CCGGCACGTTGTGCACTGACCTTTGCTCGAGCAAAGGTCAGTGCACAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014555
TRPM5 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-2395s1c1
Sequence:CCGGGTGAAGAAGTTCACACTGTATCTCGAGATACAGTGTGAACTTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-2554s1c1
Sequence:CCGGCTGATCCATATCTTTGCCATACTCGAGTATGGCAAAGATATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-1983s1c1
Sequence:CCGGCCTCGTCTATACCAACCTCATCTCGAGATGAGGTTGGTATAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-876s1c1
Sequence:CCGGGCATTTCTCTTGGGAGGACATCTCGAGATGTCCTCCCAAGAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-2318s1c1
Sequence:CCGGCCCTCTACTTCTGGGTCTTTACTCGAGTAAAGACCCAGAAGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014555.3-2598s21c1
Sequence:CCGGCATCGTGGTAGAGCGCATGATCTCGAGATCATGCGCTCTACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014555.3-3559s21c1
Sequence:CCGGCACGTTGTGCACTGACCTTTGCTCGAGCAAAGGTCAGTGCACAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014555
TRPM5 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-2395s1c1
Sequence:CCGGGTGAAGAAGTTCACACTGTATCTCGAGATACAGTGTGAACTTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-2554s1c1
Sequence:CCGGCTGATCCATATCTTTGCCATACTCGAGTATGGCAAAGATATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-1983s1c1
Sequence:CCGGCCTCGTCTATACCAACCTCATCTCGAGATGAGGTTGGTATAGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-876s1c1
Sequence:CCGGGCATTTCTCTTGGGAGGACATCTCGAGATGTCCTCCCAAGAGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014555.2-2318s1c1
Sequence:CCGGCCCTCTACTTCTGGGTCTTTACTCGAGTAAAGACCCAGAAGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014555.3-2598s21c1
Sequence:CCGGCATCGTGGTAGAGCGCATGATCTCGAGATCATGCGCTCTACCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014555.3-3559s21c1
Sequence:CCGGCACGTTGTGCACTGACCTTTGCTCGAGCAAAGGTCAGTGCACAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks