EMAIL THIS PAGE TO A FRIEND

TRPM6

transient receptor potential cation channel, subfamily M, member 6

Synonyms: CHAK2 HMGX HOMG HOMG1 HSH
UniProtKB ID: Q9BX84, Q6VPR8, Q6VPR9, Q6VPS0, Q6VPS1, Q6VPS2
Gene ID:
Human(140803) Summary: This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
Mouse(225997) transient receptor potential cation channel, subfamily M, member 6
Rat(293874) transient receptor potential cation channel, subfamily M, member 6
naked mole-rat(101707911) transient receptor potential cation channel, subfamily M, member 6
domestic guinea pig(100734915) transient receptor potential cation channel, subfamily M, member 6
cow(527597) transient receptor potential cation channel, subfamily M, member 6
sheep(101114337) transient receptor potential cation channel, subfamily M, member 6
Zebrafish(100149353) transient receptor potential cation channel, subfamily M, member 6
domestic cat(101092301) transient receptor potential cation channel, subfamily M, member 6
Horse(100054478) transient receptor potential cation channel, subfamily M, member 6
dog(484163) transient receptor potential cation channel, subfamily M, member 6
chicken(100859603) transient receptor potential cation channel, subfamily M, member 6
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017662 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017662 Rosetta Predictions human pricing
XM_001078158 Rosetta Predictions rat pricing
XM_219747 Rosetta Predictions rat pricing
NM_153417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122368 predicted 5180
2 SASI_Hs02_00350380 predicted 1757
3 SASI_Hs01_00122371 predicted 6024
4 SASI_Hs01_00122372 predicted 2882
5 SASI_Hs01_00122374 predicted 2343
6 SASI_Hs01_00122375 predicted 3050
7 SASI_Hs02_00350381 predicted 732
8 SASI_Hs02_00350382 predicted 437
9 SASI_Hs02_00350383 predicted 3642
10 SASI_Hs02_00350384 predicted 3614
11 SASI_Hs01_00122369 predicted 1702
12 SASI_Hs01_00122370 predicted 6063
13 SASI_Hs01_00122373 predicted 5102
14 SASI_Hs01_00122376 predicted 2150
15 SASI_Hs01_00122377 predicted 4249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359839 predicted 4605
2 SASI_Rn02_00359840 predicted 1116
3 SASI_Rn02_00359841 predicted 4930
4 SASI_Rn02_00359842 predicted 2103
5 SASI_Rn02_00359843 predicted 2811
6 SASI_Rn02_00359844 predicted 1189
7 SASI_Rn02_00359845 predicted 4978
8 SASI_Rn02_00359846 predicted 4225
9 SASI_Rn02_00359847 predicted 4897
10 SASI_Rn02_00359848 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378669 predicted 4599
2 SASI_Rn02_00378670 predicted 3028
3 SASI_Rn02_00378671 predicted 1118
4 SASI_Rn02_00378672 predicted 255
5 SASI_Rn02_00378673 predicted 2101
6 SASI_Rn02_00378674 predicted 2810
7 SASI_Rn02_00378675 predicted 3405
8 SASI_Rn02_00378676 predicted 1186
9 SASI_Rn02_00378677 predicted 4228
10 SASI_Rn02_00378678 predicted 1533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176077 predicted 546
2 SASI_Mm02_00343207 predicted 4852
3 SASI_Mm01_00176078 predicted 5056
4 SASI_Mm01_00176079 predicted 5884
5 SASI_Mm01_00176080 predicted 2880
6 SASI_Mm02_00343208 predicted 4079
7 SASI_Mm01_00176082 predicted 4176
8 SASI_Mm01_00176083 predicted 2155
9 SASI_Mm01_00176085 predicted 5664
10 SASI_Mm01_00176086 predicted 2316
11 SASI_Mm01_00176081 predicted 5186
12 SASI_Mm01_00176084 predicted 3475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153417
VALIDATED
TRPM6 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153417.1-298s21c1
Sequence:CCGGGATACCTTCGGCACCATTAATCTCGAGATTAATGGTGCCGAAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153417.1-5403s21c1
Sequence:CCGGCCGCAAAGCCATGCGAGTTATCTCGAGATAACTCGCATGGCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153417.1-3714s21c1
Sequence:CCGGCATAACTGTTGACACCTTAAACTCGAGTTTAAGGTGTCAACAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-4664s1c1
Sequence:CCGGGCAGAGATAAAGCTCTCATTACTCGAGTAATGAGAGCTTTATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-158s1c1
Sequence:CCGGGCCACAATTTAGTCAGGTGTTCTCGAGAACACCTGACTAAATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153417.1-5715s1c1
Sequence:CCGGCCGGAAATACAATAACAACAACTCGAGTTGTTGTTATTGTATTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-1779s1c1
Sequence:CCGGGCCCTACAAATCCAAGGAGAACTCGAGTTCTCCTTGGATTTGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-3373s1c1
Sequence:CCGGCCTCCCTTTATCCTGCTGAATCTCGAGATTCAGCAGGATAAAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153417
VALIDATED
TRPM6 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153417.1-298s21c1
Sequence:CCGGGATACCTTCGGCACCATTAATCTCGAGATTAATGGTGCCGAAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153417.1-5403s21c1
Sequence:CCGGCCGCAAAGCCATGCGAGTTATCTCGAGATAACTCGCATGGCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153417.1-3714s21c1
Sequence:CCGGCATAACTGTTGACACCTTAAACTCGAGTTTAAGGTGTCAACAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-4664s1c1
Sequence:CCGGGCAGAGATAAAGCTCTCATTACTCGAGTAATGAGAGCTTTATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-158s1c1
Sequence:CCGGGCCACAATTTAGTCAGGTGTTCTCGAGAACACCTGACTAAATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153417.1-5715s1c1
Sequence:CCGGCCGGAAATACAATAACAACAACTCGAGTTGTTGTTATTGTATTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-1779s1c1
Sequence:CCGGGCCCTACAAATCCAAGGAGAACTCGAGTTCTCCTTGGATTTGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-3373s1c1
Sequence:CCGGCCTCCCTTTATCCTGCTGAATCTCGAGATTCAGCAGGATAAAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153417
VALIDATED
TRPM6 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153417.1-298s21c1
Sequence:CCGGGATACCTTCGGCACCATTAATCTCGAGATTAATGGTGCCGAAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153417.1-5403s21c1
Sequence:CCGGCCGCAAAGCCATGCGAGTTATCTCGAGATAACTCGCATGGCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153417.1-3714s21c1
Sequence:CCGGCATAACTGTTGACACCTTAAACTCGAGTTTAAGGTGTCAACAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-4664s1c1
Sequence:CCGGGCAGAGATAAAGCTCTCATTACTCGAGTAATGAGAGCTTTATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-158s1c1
Sequence:CCGGGCCACAATTTAGTCAGGTGTTCTCGAGAACACCTGACTAAATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153417.1-5715s1c1
Sequence:CCGGCCGGAAATACAATAACAACAACTCGAGTTGTTGTTATTGTATTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-1779s1c1
Sequence:CCGGGCCCTACAAATCCAAGGAGAACTCGAGTTCTCCTTGGATTTGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153417.1-3373s1c1
Sequence:CCGGCCTCCCTTTATCCTGCTGAATCTCGAGATTCAGCAGGATAAAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017662
TRPM6 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-4728s1c1
Sequence:CCGGGCTCCCTATCTGATAACTCAACTCGAGTTGAGTTATCAGATAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-4280s1c1
Sequence:CCGGCCCTCTAATCTAAAGCGAGTTCTCGAGAACTCGCTTTAGATTAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017662.3-7665s1c1
Sequence:CCGGCCTGGCATAAAGAATGTATATCTCGAGATATACATTCTTTATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-1336s1c1
Sequence:CCGGCCAAATTCTAATGGAGTGTATCTCGAGATACACTCCATTAGAATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-5887s1c1
Sequence:CCGGCCGGAAGTATAACAACAACAACTCGAGTTGTTGTTGTTATACTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-1795s1c1
Sequence:CCGGCCTCATTGGTAGAGCATATCGCTCGAGCGATATGCTCTACCAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-6031s1c1
Sequence:CCGGGACAGATCCATCTGTTATAAACTCGAGTTTATAACAGATGGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017662.3-8116s1c1
Sequence:CCGGGAGTTCCACAAGGGCTAATTTCTCGAGAAATTAGCCCTTGTGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-5528s1c1
Sequence:CCGGGCGGCAATGATCCAGGTATTGCTCGAGCAATACCTGGATCATTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017662.3-8172s1c1
Sequence:CCGGGCGGGAAATTTGGGTGATTTGCTCGAGCAAATCACCCAAATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017662
TRPM6 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-4728s1c1
Sequence:CCGGGCTCCCTATCTGATAACTCAACTCGAGTTGAGTTATCAGATAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-4280s1c1
Sequence:CCGGCCCTCTAATCTAAAGCGAGTTCTCGAGAACTCGCTTTAGATTAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017662.3-7665s1c1
Sequence:CCGGCCTGGCATAAAGAATGTATATCTCGAGATATACATTCTTTATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-1336s1c1
Sequence:CCGGCCAAATTCTAATGGAGTGTATCTCGAGATACACTCCATTAGAATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-5887s1c1
Sequence:CCGGCCGGAAGTATAACAACAACAACTCGAGTTGTTGTTGTTATACTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-1795s1c1
Sequence:CCGGCCTCATTGGTAGAGCATATCGCTCGAGCGATATGCTCTACCAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-6031s1c1
Sequence:CCGGGACAGATCCATCTGTTATAAACTCGAGTTTATAACAGATGGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017662.3-8116s1c1
Sequence:CCGGGAGTTCCACAAGGGCTAATTTCTCGAGAAATTAGCCCTTGTGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-5528s1c1
Sequence:CCGGGCGGCAATGATCCAGGTATTGCTCGAGCAATACCTGGATCATTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017662.3-8172s1c1
Sequence:CCGGGCGGGAAATTTGGGTGATTTGCTCGAGCAAATCACCCAAATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017662
TRPM6 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-4728s1c1
Sequence:CCGGGCTCCCTATCTGATAACTCAACTCGAGTTGAGTTATCAGATAGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-4280s1c1
Sequence:CCGGCCCTCTAATCTAAAGCGAGTTCTCGAGAACTCGCTTTAGATTAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017662.3-7665s1c1
Sequence:CCGGCCTGGCATAAAGAATGTATATCTCGAGATATACATTCTTTATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-1336s1c1
Sequence:CCGGCCAAATTCTAATGGAGTGTATCTCGAGATACACTCCATTAGAATTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-5887s1c1
Sequence:CCGGCCGGAAGTATAACAACAACAACTCGAGTTGTTGTTGTTATACTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-1795s1c1
Sequence:CCGGCCTCATTGGTAGAGCATATCGCTCGAGCGATATGCTCTACCAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-6031s1c1
Sequence:CCGGGACAGATCCATCTGTTATAAACTCGAGTTTATAACAGATGGATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017662.3-8116s1c1
Sequence:CCGGGAGTTCCACAAGGGCTAATTTCTCGAGAAATTAGCCCTTGTGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017662.3-5528s1c1
Sequence:CCGGGCGGCAATGATCCAGGTATTGCTCGAGCAATACCTGGATCATTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017662.3-8172s1c1
Sequence:CCGGGCGGGAAATTTGGGTGATTTGCTCGAGCAAATCACCCAAATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks