EMAIL THIS PAGE TO A FRIEND

TRPM7

transient receptor potential cation channel, subfamily M, member 7

Synonyms: ALSPDC CHAK CHAK1 LTRPC7 TRP-PLIK
UniProtKB ID: Q96QT4, Q6ZMF5, Q86VJ4, Q8NBW2, Q9BXB2, Q9NXQ2
Gene ID:
Human(54822) Summary: The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam.[provided by RefSeq, May 2010]
Mouse(58800) transient receptor potential cation channel, subfamily M, member 7
Rat(679906) transient receptor potential cation channel, subfamily M, member 7
Zebrafish(280653) transient receptor potential cation channel, subfamily M, member 7
chicken(427502) transient receptor potential cation channel, subfamily M, member 7
Horse(100034101) transient receptor potential cation channel, subfamily M, member 7
dog(478300) transient receptor potential cation channel, subfamily M, member 7
cow(514642) transient receptor potential cation channel, subfamily M, member 7
sheep(100037693) transient receptor potential cation channel, subfamily M, member 7
domestic guinea pig(100716553) transient receptor potential cation channel, subfamily M, member 7
naked mole-rat(101709993) transient receptor potential cation channel, subfamily M, member 7
Gene Class: Cytoskeleton
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017672 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017672 Rosetta Predictions human pricing
XM_001056331 Rosetta Predictions rat pricing
NM_021450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120022 predicted 575
2 SASI_Hs01_00120023 predicted 1713
3 SASI_Hs01_00120024 predicted 3513
4 SASI_Hs01_00120027 predicted 5542
5 SASI_Hs01_00120028 predicted 5024
6 SASI_Hs01_00120029 predicted 3396
7 SASI_Hs02_00350402 predicted 910
8 SASI_Hs02_00350403 predicted 601
9 SASI_Hs02_00350404 predicted 2223
10 SASI_Hs02_00350405 predicted 2742
11 SASI_Hs01_00120025 predicted 2360
12 SASI_Hs01_00120026 predicted 5155
13 SASI_Hs01_00120030 predicted 2542
14 SASI_Hs01_00120031 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282940 predicted 5398
2 SASI_Rn02_00282941 predicted 5772
3 SASI_Rn02_00282942 predicted 5281
4 SASI_Rn02_00282943 predicted 5420
5 SASI_Rn02_00282944 predicted 5728
6 SASI_Rn02_00282945 predicted 5727
7 SASI_Rn02_00282946 predicted 5727
8 SASI_Rn02_00282947 predicted 5331
9 SASI_Rn02_00282948 predicted 5668
10 SASI_Rn02_00282949 predicted 5778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125908 predicted 427
2 SASI_Mm01_00125909 predicted 5503
3 SASI_Mm02_00326100 predicted 495
4 SASI_Mm01_00125910 predicted 3481
5 SASI_Mm01_00125911 predicted 2499
6 SASI_Mm01_00125912 predicted 2890
7 SASI_Mm02_00326101 predicted 4705
8 SASI_Mm01_00125915 predicted 1570
9 SASI_Mm01_00125917 predicted 3491
10 SASI_Mm02_00326102 predicted 5817
11 SASI_Mm01_00125913 predicted 3571
12 SASI_Mm01_00125914 predicted 631
13 SASI_Mm01_00125916 predicted 3537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017672
VALIDATED
TRPM7 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017672.2-2351s1c1
Sequence:CCGGGCTATGAAATTGCTCACTTATCTCGAGATAAGTGAGCAATTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017672.2-7076s1c1
Sequence:CCGGCAAGAGATGATAAGCTGTTTACTCGAGTAAACAGCTTATCATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017672.2-504s1c1
Sequence:CCGGCGGATGCTTATGGAGTCATAACTCGAGTTATGACTCCATAAGCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017672.2-5787s1c1
Sequence:CCGGCCACCAAAGAATCAGAATCAACTCGAGTTGATTCTGATTCTTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017672.2-1267s1c1
Sequence:CCGGGCCCGATATTATTTCCACTATCTCGAGATAGTGGAAATAATATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017672.2-5901s1c1
Sequence:CCGGCGGGAGGAAATTGTTTGGTAACTCGAGTTACCAAACAATTTCCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017672.3-2112s21c1
Sequence:GTACCGGGCGCTTTCCTTATCCACTTAACTCGAGTTAAGTGGATAAGGAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017672.3-1228s21c1
Sequence:GTACCGGGCAGATCTGCTAGCGTATATTCTCGAGAATATACGCTAGCAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-3256s21c1
Sequence:CCGGGCCAATATGTTCTACATTGTACTCGAGTACAATGTAGAACATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-1293s21c1
Sequence:CCGGGCCCGATATTATTTCCACTATCTCGAGATAGTGGAAATAATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-5816s21c1
Sequence:CCGGCCACCAAAGAATCAGAATCAACTCGAGTTGATTCTGATTCTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-5930s21c1
Sequence:CCGGCGGGAGGAAATTGTTTGGTAACTCGAGTTACCAAACAATTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017672
VALIDATED
TRPM7 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017672.2-2351s1c1
Sequence:CCGGGCTATGAAATTGCTCACTTATCTCGAGATAAGTGAGCAATTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017672.2-7076s1c1
Sequence:CCGGCAAGAGATGATAAGCTGTTTACTCGAGTAAACAGCTTATCATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017672.2-504s1c1
Sequence:CCGGCGGATGCTTATGGAGTCATAACTCGAGTTATGACTCCATAAGCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017672.2-5787s1c1
Sequence:CCGGCCACCAAAGAATCAGAATCAACTCGAGTTGATTCTGATTCTTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017672.2-1267s1c1
Sequence:CCGGGCCCGATATTATTTCCACTATCTCGAGATAGTGGAAATAATATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017672.2-5901s1c1
Sequence:CCGGCGGGAGGAAATTGTTTGGTAACTCGAGTTACCAAACAATTTCCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017672.3-2112s21c1
Sequence:GTACCGGGCGCTTTCCTTATCCACTTAACTCGAGTTAAGTGGATAAGGAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017672.3-1228s21c1
Sequence:GTACCGGGCAGATCTGCTAGCGTATATTCTCGAGAATATACGCTAGCAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-3256s21c1
Sequence:CCGGGCCAATATGTTCTACATTGTACTCGAGTACAATGTAGAACATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-1293s21c1
Sequence:CCGGGCCCGATATTATTTCCACTATCTCGAGATAGTGGAAATAATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-5816s21c1
Sequence:CCGGCCACCAAAGAATCAGAATCAACTCGAGTTGATTCTGATTCTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-5930s21c1
Sequence:CCGGCGGGAGGAAATTGTTTGGTAACTCGAGTTACCAAACAATTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017672
VALIDATED
TRPM7 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017672.2-2351s1c1
Sequence:CCGGGCTATGAAATTGCTCACTTATCTCGAGATAAGTGAGCAATTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017672.2-7076s1c1
Sequence:CCGGCAAGAGATGATAAGCTGTTTACTCGAGTAAACAGCTTATCATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017672.2-504s1c1
Sequence:CCGGCGGATGCTTATGGAGTCATAACTCGAGTTATGACTCCATAAGCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017672.2-5787s1c1
Sequence:CCGGCCACCAAAGAATCAGAATCAACTCGAGTTGATTCTGATTCTTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017672.2-1267s1c1
Sequence:CCGGGCCCGATATTATTTCCACTATCTCGAGATAGTGGAAATAATATCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017672.2-5901s1c1
Sequence:CCGGCGGGAGGAAATTGTTTGGTAACTCGAGTTACCAAACAATTTCCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017672.3-2112s21c1
Sequence:GTACCGGGCGCTTTCCTTATCCACTTAACTCGAGTTAAGTGGATAAGGAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017672.3-1228s21c1
Sequence:GTACCGGGCAGATCTGCTAGCGTATATTCTCGAGAATATACGCTAGCAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-3256s21c1
Sequence:CCGGGCCAATATGTTCTACATTGTACTCGAGTACAATGTAGAACATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-1293s21c1
Sequence:CCGGGCCCGATATTATTTCCACTATCTCGAGATAGTGGAAATAATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-5816s21c1
Sequence:CCGGCCACCAAAGAATCAGAATCAACTCGAGTTGATTCTGATTCTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017672.3-5930s21c1
Sequence:CCGGCGGGAGGAAATTGTTTGGTAACTCGAGTTACCAAACAATTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021450
VALIDATED
TRPM7 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-4488s1c1
Sequence:CCGGCCAAAGATCAAGAACCCATTTCTCGAGAAATGGGTTCTTGATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-2505s1c1
Sequence:CCGGCCTGGTATAAGGTCATATTAACTCGAGTTAATATGACCTTATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-905s1c1
Sequence:CCGGCCTTATCAAACCCTATTGAATCTCGAGATTCAATAGGGTTTGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021450.1-5738s1c1
Sequence:CCGGCCTCAGGATGAGTCATCAGATCTCGAGATCTGATGACTCATCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-4058s1c1
Sequence:CCGGGCTCAGAATCTTATTGATGATCTCGAGATCATCAATAAGATTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-905s21c1
Sequence:CCGGCCTTATCAAACCCTATTGAATCTCGAGATTCAATAGGGTTTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-3164s21c1
Sequence:CCGGCTAGACTTTCTAGCCGTAAATCTCGAGATTTACGGCTAGAAAGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-2893s21c1
Sequence:CCGGATGGATTGTTATCGCTTATATCTCGAGATATAAGCGATAACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-4488s21c1
Sequence:CCGGCCAAAGATCAAGAACCCATTTCTCGAGAAATGGGTTCTTGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021450.1-6079s21c1
Sequence:CCGGACCTGGTGCAGGACCATTAACCTCGAGGTTAATGGTCCTGCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021450
VALIDATED
TRPM7 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-4488s1c1
Sequence:CCGGCCAAAGATCAAGAACCCATTTCTCGAGAAATGGGTTCTTGATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-2505s1c1
Sequence:CCGGCCTGGTATAAGGTCATATTAACTCGAGTTAATATGACCTTATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-905s1c1
Sequence:CCGGCCTTATCAAACCCTATTGAATCTCGAGATTCAATAGGGTTTGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021450.1-5738s1c1
Sequence:CCGGCCTCAGGATGAGTCATCAGATCTCGAGATCTGATGACTCATCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-4058s1c1
Sequence:CCGGGCTCAGAATCTTATTGATGATCTCGAGATCATCAATAAGATTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-905s21c1
Sequence:CCGGCCTTATCAAACCCTATTGAATCTCGAGATTCAATAGGGTTTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-3164s21c1
Sequence:CCGGCTAGACTTTCTAGCCGTAAATCTCGAGATTTACGGCTAGAAAGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-2893s21c1
Sequence:CCGGATGGATTGTTATCGCTTATATCTCGAGATATAAGCGATAACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-4488s21c1
Sequence:CCGGCCAAAGATCAAGAACCCATTTCTCGAGAAATGGGTTCTTGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021450.1-6079s21c1
Sequence:CCGGACCTGGTGCAGGACCATTAACCTCGAGGTTAATGGTCCTGCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021450
VALIDATED
TRPM7 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-4488s1c1
Sequence:CCGGCCAAAGATCAAGAACCCATTTCTCGAGAAATGGGTTCTTGATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-2505s1c1
Sequence:CCGGCCTGGTATAAGGTCATATTAACTCGAGTTAATATGACCTTATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-905s1c1
Sequence:CCGGCCTTATCAAACCCTATTGAATCTCGAGATTCAATAGGGTTTGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021450.1-5738s1c1
Sequence:CCGGCCTCAGGATGAGTCATCAGATCTCGAGATCTGATGACTCATCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021450.1-4058s1c1
Sequence:CCGGGCTCAGAATCTTATTGATGATCTCGAGATCATCAATAAGATTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-905s21c1
Sequence:CCGGCCTTATCAAACCCTATTGAATCTCGAGATTCAATAGGGTTTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-3164s21c1
Sequence:CCGGCTAGACTTTCTAGCCGTAAATCTCGAGATTTACGGCTAGAAAGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-2893s21c1
Sequence:CCGGATGGATTGTTATCGCTTATATCTCGAGATATAAGCGATAACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021450.1-4488s21c1
Sequence:CCGGCCAAAGATCAAGAACCCATTTCTCGAGAAATGGGTTCTTGATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021450.1-6079s21c1
Sequence:CCGGACCTGGTGCAGGACCATTAACCTCGAGGTTAATGGTCCTGCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks