EMAIL THIS PAGE TO A FRIEND

TRPM8

transient receptor potential cation channel, subfamily M, member 8

Synonyms: LTRPC6 TRPP8
UniProtKB ID: Q7Z2W7, Q3YFM7, Q6QNH9, Q8TAC3, Q8TDX8, Q9BVK1
Gene ID:
Mouse(171382) transient receptor potential cation channel, subfamily M, member 8
Rat(171384) transient receptor potential cation channel, subfamily M, member 8
naked mole-rat(101709840) transient receptor potential cation channel, subfamily M, member 8
Domestic Rabbit(100328692) transient receptor potential cation channel, subfamily M, member 8
domestic guinea pig(100337634) transient receptor potential cation channel, subfamily M, member 8
cow(541151) transient receptor potential cation channel, subfamily M, member 8
sheep(101104537) transient receptor potential cation channel, subfamily M, member 8
chicken(424025) transient receptor potential cation channel, subfamily M, member 8
Horse(100057419) transient receptor potential cation channel, subfamily M, member 8
domestic cat(101101245) transient receptor potential cation channel, subfamily M, member 8
dog(486170) transient receptor potential cation channel, subfamily M, member 8
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024080 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU058611 MISSION® esiRNA esiRNA targeting mouse Trpm8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024080 Rosetta Predictions human pricing
NM_134371 Rosetta Predictions rat pricing
NM_134252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158026 predicted 277
2 SASI_Hs01_00158027 predicted 1555
3 SASI_Hs02_00356549 predicted 3108
4 SASI_Hs01_00158030 predicted 900
5 SASI_Hs01_00158031 predicted 3304
6 SASI_Hs01_00158032 predicted 1190
7 SASI_Hs01_00158033 predicted 3294
8 SASI_Hs01_00158034 predicted 1565
9 SASI_Hs01_00158035 predicted 2556
10 SASI_Hs02_00356550 predicted 885
11 SASI_Hs01_00158028 predicted 2182
12 SASI_Hs01_00158029 predicted 2129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049376 predicted 910
2 SASI_Rn01_00049377 predicted 723
3 SASI_Rn01_00049378 predicted 2304
4 SASI_Rn01_00049381 predicted 394
5 SASI_Rn01_00049382 predicted 621
6 SASI_Rn01_00049383 predicted 2798
7 SASI_Rn01_00049384 predicted 1449
8 SASI_Rn02_00267933 predicted 3307
9 SASI_Rn01_00049385 predicted 2429
10 SASI_Rn02_00267934 predicted 199
11 SASI_Rn01_00049379 predicted 2485
12 SASI_Rn01_00049380 predicted 2944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119773 predicted 1039
2 SASI_Mm01_00119774 predicted 326
3 SASI_Mm01_00119775 predicted 1112
4 SASI_Mm01_00119776 predicted 693
5 SASI_Mm02_00339558 predicted 2094
6 SASI_Mm01_00119777 predicted 1580
7 SASI_Mm01_00119778 predicted 3586
8 SASI_Mm01_00119779 predicted 453
9 SASI_Mm01_00119780 predicted 3358
10 SASI_Mm01_00119781 predicted 2294
11 SASI_Mm01_00119782 predicted 3681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134252
TRPM8 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134252.3-3187s21c1
Sequence:CCGGGGAGTACTGCAACCGCCTAAACTCGAGTTTAGGCGGTTGCAGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134252.3-1383s21c1
Sequence:CCGGAGATTGTGAGCAACGCCATTTCTCGAGAAATGGCGTTGCTCACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134252.3-2930s21c1
Sequence:CCGGGACGTGGATAGTACCACATATCTCGAGATATGTGGTACTATCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-1191s1c1
Sequence:CCGGCCCTCTATACATCCTGGACAACTCGAGTTGTCCAGGATGTATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-3487s1c1
Sequence:CCGGCCCTTCGTTGTCTTCGCTTATCTCGAGATAAGCGAAGACAACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-2892s1c1
Sequence:CCGGCCGGCTCCACTCTTCTAATAACTCGAGTTATTAGAAGAGTGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-1390s1c1
Sequence:CCGGGCCATCAACACCTCTGTCAAACTCGAGTTTGACAGAGGTGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134252.2-3851s1c1
Sequence:CCGGGTACTGCTAATGACTTCTAAACTCGAGTTTAGAAGTCATTAGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134252
TRPM8 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134252.3-3187s21c1
Sequence:CCGGGGAGTACTGCAACCGCCTAAACTCGAGTTTAGGCGGTTGCAGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134252.3-1383s21c1
Sequence:CCGGAGATTGTGAGCAACGCCATTTCTCGAGAAATGGCGTTGCTCACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134252.3-2930s21c1
Sequence:CCGGGACGTGGATAGTACCACATATCTCGAGATATGTGGTACTATCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-1191s1c1
Sequence:CCGGCCCTCTATACATCCTGGACAACTCGAGTTGTCCAGGATGTATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-3487s1c1
Sequence:CCGGCCCTTCGTTGTCTTCGCTTATCTCGAGATAAGCGAAGACAACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-2892s1c1
Sequence:CCGGCCGGCTCCACTCTTCTAATAACTCGAGTTATTAGAAGAGTGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-1390s1c1
Sequence:CCGGGCCATCAACACCTCTGTCAAACTCGAGTTTGACAGAGGTGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134252.2-3851s1c1
Sequence:CCGGGTACTGCTAATGACTTCTAAACTCGAGTTTAGAAGTCATTAGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134252
TRPM8 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134252.3-3187s21c1
Sequence:CCGGGGAGTACTGCAACCGCCTAAACTCGAGTTTAGGCGGTTGCAGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134252.3-1383s21c1
Sequence:CCGGAGATTGTGAGCAACGCCATTTCTCGAGAAATGGCGTTGCTCACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134252.3-2930s21c1
Sequence:CCGGGACGTGGATAGTACCACATATCTCGAGATATGTGGTACTATCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-1191s1c1
Sequence:CCGGCCCTCTATACATCCTGGACAACTCGAGTTGTCCAGGATGTATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-3487s1c1
Sequence:CCGGCCCTTCGTTGTCTTCGCTTATCTCGAGATAAGCGAAGACAACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-2892s1c1
Sequence:CCGGCCGGCTCCACTCTTCTAATAACTCGAGTTATTAGAAGAGTGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134252.2-1390s1c1
Sequence:CCGGGCCATCAACACCTCTGTCAAACTCGAGTTTGACAGAGGTGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134252.2-3851s1c1
Sequence:CCGGGTACTGCTAATGACTTCTAAACTCGAGTTTAGAAGTCATTAGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024080
TRPM8 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily M, member 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024080.4-727s21c1
Sequence:CCGGTTGCGATGCTGAGGGCTATTTCTCGAGAAATAGCCCTCAGCATCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024080.4-3535s21c1
Sequence:CCGGTCATACTTGAAGACGGATATACTCGAGTATATCCGTCTTCAAGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-645s1c1
Sequence:CCGGGCAGGAGTTCAGAGGAGAATACTCGAGTATTCTCCTCTGAACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-901s1c1
Sequence:CCGGGCGCACTATTCAAGATTCCAACTCGAGTTGGAATCTTGAATAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-754s1c1
Sequence:CCGGCCAGTACCTTATGGATGACTTCTCGAGAAGTCATCCATAAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-2486s1c1
Sequence:CCGGCGGCTCCACTCTTCTAATAAACTCGAGTTTATTAGAAGAGTGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-2157s1c1
Sequence:CCGGGCTGTGGCTTTGTATCATTTACTCGAGTAAATGATACAAAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024080
TRPM8 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily M, member 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024080.4-727s21c1
Sequence:CCGGTTGCGATGCTGAGGGCTATTTCTCGAGAAATAGCCCTCAGCATCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024080.4-3535s21c1
Sequence:CCGGTCATACTTGAAGACGGATATACTCGAGTATATCCGTCTTCAAGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-645s1c1
Sequence:CCGGGCAGGAGTTCAGAGGAGAATACTCGAGTATTCTCCTCTGAACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-901s1c1
Sequence:CCGGGCGCACTATTCAAGATTCCAACTCGAGTTGGAATCTTGAATAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-754s1c1
Sequence:CCGGCCAGTACCTTATGGATGACTTCTCGAGAAGTCATCCATAAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-2486s1c1
Sequence:CCGGCGGCTCCACTCTTCTAATAAACTCGAGTTTATTAGAAGAGTGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-2157s1c1
Sequence:CCGGGCTGTGGCTTTGTATCATTTACTCGAGTAAATGATACAAAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024080
TRPM8 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily M, member 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024080.4-727s21c1
Sequence:CCGGTTGCGATGCTGAGGGCTATTTCTCGAGAAATAGCCCTCAGCATCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024080.4-3535s21c1
Sequence:CCGGTCATACTTGAAGACGGATATACTCGAGTATATCCGTCTTCAAGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-645s1c1
Sequence:CCGGGCAGGAGTTCAGAGGAGAATACTCGAGTATTCTCCTCTGAACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-901s1c1
Sequence:CCGGGCGCACTATTCAAGATTCCAACTCGAGTTGGAATCTTGAATAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-754s1c1
Sequence:CCGGCCAGTACCTTATGGATGACTTCTCGAGAAGTCATCCATAAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-2486s1c1
Sequence:CCGGCGGCTCCACTCTTCTAATAAACTCGAGTTTATTAGAAGAGTGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024080.3-2157s1c1
Sequence:CCGGGCTGTGGCTTTGTATCATTTACTCGAGTAAATGATACAAAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks