EMAIL THIS PAGE TO A FRIEND

TRPS1

trichorhinophalangeal syndrome I

Synonyms: GC79 LGCR
UniProtKB ID: Q9UHF7, B4E1Z5, Q08AU2, Q9NWE1, Q9UHH6
Gene ID:
Human(7227) Summary: This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
Mouse(83925) trichorhinophalangeal syndrome I (human)
Rat(299897) trichorhinophalangeal syndrome I
Zebrafish(795613) trichorhinophalangeal syndrome I
Horse(100056821) trichorhinophalangeal syndrome I
domestic cat(101093494) trichorhinophalangeal syndrome I
dog(482018) trichorhinophalangeal syndrome I
chicken(420289) trichorhinophalangeal syndrome I
cow(537652) trichorhinophalangeal syndrome I
sheep(101116062) trichorhinophalangeal syndrome I
domestic guinea pig(100721120) trichorhinophalangeal syndrome I
naked mole-rat(101701844) trichorhinophalangeal syndrome I
296 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032000 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032000 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032000 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014112 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003611 MISSION® esiRNA esiRNA targeting human TRPS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014112 Rosetta Predictions human pricing
NM_001134837 Rosetta Predictions rat pricing
NM_032000 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225504 predicted 3339
2 SASI_Hs01_00225505 predicted 1645
3 SASI_Hs01_00225506 predicted 3761
4 SASI_Hs01_00225508 predicted 1328
5 SASI_Hs01_00225509 predicted 3824
6 SASI_Hs01_00225510 predicted 3079
7 SASI_Hs02_00345122 predicted 3525
8 SASI_Hs01_00225511 predicted 1342
9 SASI_Hs01_00225512 predicted 1904
10 SASI_Hs02_00345123 predicted 2664
11 SASI_Hs01_00225507 predicted 4088
12 SASI_Hs01_00225513 predicted 3137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258644 predicted 2912
2 SASI_Rn02_00258645 predicted 900
3 SASI_Rn02_00258646 predicted 1482
4 SASI_Rn02_00258647 predicted 793
5 SASI_Rn02_00258648 predicted 3137
6 SASI_Rn02_00258649 predicted 919
7 SASI_Rn02_00258650 predicted 2928
8 SASI_Rn02_00258651 predicted 3337
9 SASI_Rn02_00258652 predicted 3046
10 SASI_Rn02_00258653 predicted 1854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095121 predicted 1836
2 SASI_Mm01_00095122 predicted 1045
3 SASI_Mm01_00095123 predicted 3578
4 SASI_Mm02_00337205 predicted 4067
5 SASI_Mm01_00095124 predicted 3912
6 SASI_Mm01_00095125 predicted 1147
7 SASI_Mm02_00337206 predicted 1775
8 SASI_Mm01_00095127 predicted 3163
9 SASI_Mm01_00095128 predicted 1167
10 SASI_Mm01_00095129 predicted 3290
11 SASI_Mm01_00095126 predicted 1661
12 SASI_Mm01_00095130 predicted 2047
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032000
VALIDATED
TRPS1 MISSION shRNA Bacterial Glycerol Stock
trichorhinophalangeal syndrome I
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_032000.1-4214s1c1
Sequence:CCGGCCTTAGCACTTAGCACAATTACTCGAGTAATTGTGCTAAGTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_032000.1-1760s1c1
Sequence:CCGGCGGCCTTAATCCAGAGTTGAACTCGAGTTCAACTCTGGATTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_032000.1-3153s1c1
Sequence:CCGGCCCAGGCCTTTAAACATCATTCTCGAGAATGATGTTTAAAGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032000.1-1364s1c1
Sequence:CCGGCCGCTGCAAATTCTGCAATTTCTCGAGAAATTGCAGAATTTGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032000.1-3763s1c1
Sequence:CCGGGCTTACCAAATCCTTGCCAAACTCGAGTTTGGCAAGGATTTGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032000.2-4186s21c1
Sequence:CCGGAGCATCTTTGCACGGACAAATCTCGAGATTTGTCCGTGCAAAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032000.2-3281s21c1
Sequence:CCGGACGGACAAGAAAGCGCCTTAACTCGAGTTAAGGCGCTTTCTTGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032000
VALIDATED
TRPS1 MISSION shRNA shRNA Plasmid DNA
trichorhinophalangeal syndrome I
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_032000.1-4214s1c1
Sequence:CCGGCCTTAGCACTTAGCACAATTACTCGAGTAATTGTGCTAAGTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_032000.1-1760s1c1
Sequence:CCGGCGGCCTTAATCCAGAGTTGAACTCGAGTTCAACTCTGGATTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_032000.1-3153s1c1
Sequence:CCGGCCCAGGCCTTTAAACATCATTCTCGAGAATGATGTTTAAAGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032000.1-1364s1c1
Sequence:CCGGCCGCTGCAAATTCTGCAATTTCTCGAGAAATTGCAGAATTTGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032000.1-3763s1c1
Sequence:CCGGGCTTACCAAATCCTTGCCAAACTCGAGTTTGGCAAGGATTTGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032000.2-4186s21c1
Sequence:CCGGAGCATCTTTGCACGGACAAATCTCGAGATTTGTCCGTGCAAAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032000.2-3281s21c1
Sequence:CCGGACGGACAAGAAAGCGCCTTAACTCGAGTTAAGGCGCTTTCTTGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032000
VALIDATED
TRPS1 MISSION shRNA Lentiviral Transduction Particles
trichorhinophalangeal syndrome I
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_032000.1-4214s1c1
Sequence:CCGGCCTTAGCACTTAGCACAATTACTCGAGTAATTGTGCTAAGTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_032000.1-1760s1c1
Sequence:CCGGCGGCCTTAATCCAGAGTTGAACTCGAGTTCAACTCTGGATTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_032000.1-3153s1c1
Sequence:CCGGCCCAGGCCTTTAAACATCATTCTCGAGAATGATGTTTAAAGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032000.1-1364s1c1
Sequence:CCGGCCGCTGCAAATTCTGCAATTTCTCGAGAAATTGCAGAATTTGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032000.1-3763s1c1
Sequence:CCGGGCTTACCAAATCCTTGCCAAACTCGAGTTTGGCAAGGATTTGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032000.2-4186s21c1
Sequence:CCGGAGCATCTTTGCACGGACAAATCTCGAGATTTGTCCGTGCAAAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032000.2-3281s21c1
Sequence:CCGGACGGACAAGAAAGCGCCTTAACTCGAGTTAAGGCGCTTTCTTGTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014112
VALIDATED
TRPS1 MISSION shRNA Bacterial Glycerol Stock
trichorhinophalangeal syndrome I
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014112.1-7158s1c1
Sequence:CCGGCGGACACAAATAGGTTCTTTACTCGAGTAAAGAACCTATTTGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-3858s1c1
Sequence:CCGGCCTGCGAAACACCCAAATTATCTCGAGATAATTTGGGTGTTTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-4396s1c1
Sequence:CCGGCGGACAAATATGACTTCACAACTCGAGTTGTGAAGTCATATTTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-2032s1c1
Sequence:CCGGGCGGCCTTAATCCAGAGTTAACTCGAGTTAACTCTGGATTAAGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-1637s1c1
Sequence:CCGGCCGCTGTAAATTCTGCAATTTCTCGAGAAATTGCAGAATTTACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014112.2-3433s21c1
Sequence:CCGGACAACGGTGAGCAGATTATTACTCGAGTAATAATCTGCTCACCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014112.2-9791s21c1
Sequence:CCGGTACTAGAATGTTGGCTATAATCTCGAGATTATAGCCAACATTCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014112.2-2170s21c1
Sequence:CCGGATATGGTAACGAGCTATAATTCTCGAGAATTATAGCTCGTTACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014112.2-1851s21c1
Sequence:CCGGGGGTACTCAGTGCCCATAAAGCTCGAGCTTTATGGGCACTGAGTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014112.2-1647s21c1
Sequence:CCGGGGCAACTCATCCACCGAATTACTCGAGTAATTCGGTGGATGAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014112
VALIDATED
TRPS1 MISSION shRNA shRNA Plasmid DNA
trichorhinophalangeal syndrome I
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014112.1-7158s1c1
Sequence:CCGGCGGACACAAATAGGTTCTTTACTCGAGTAAAGAACCTATTTGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-3858s1c1
Sequence:CCGGCCTGCGAAACACCCAAATTATCTCGAGATAATTTGGGTGTTTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-4396s1c1
Sequence:CCGGCGGACAAATATGACTTCACAACTCGAGTTGTGAAGTCATATTTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-2032s1c1
Sequence:CCGGGCGGCCTTAATCCAGAGTTAACTCGAGTTAACTCTGGATTAAGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-1637s1c1
Sequence:CCGGCCGCTGTAAATTCTGCAATTTCTCGAGAAATTGCAGAATTTACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014112.2-3433s21c1
Sequence:CCGGACAACGGTGAGCAGATTATTACTCGAGTAATAATCTGCTCACCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014112.2-9791s21c1
Sequence:CCGGTACTAGAATGTTGGCTATAATCTCGAGATTATAGCCAACATTCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014112.2-2170s21c1
Sequence:CCGGATATGGTAACGAGCTATAATTCTCGAGAATTATAGCTCGTTACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014112.2-1851s21c1
Sequence:CCGGGGGTACTCAGTGCCCATAAAGCTCGAGCTTTATGGGCACTGAGTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014112.2-1647s21c1
Sequence:CCGGGGCAACTCATCCACCGAATTACTCGAGTAATTCGGTGGATGAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014112
VALIDATED
TRPS1 MISSION shRNA Lentiviral Transduction Particles
trichorhinophalangeal syndrome I
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014112.1-7158s1c1
Sequence:CCGGCGGACACAAATAGGTTCTTTACTCGAGTAAAGAACCTATTTGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-3858s1c1
Sequence:CCGGCCTGCGAAACACCCAAATTATCTCGAGATAATTTGGGTGTTTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-4396s1c1
Sequence:CCGGCGGACAAATATGACTTCACAACTCGAGTTGTGAAGTCATATTTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-2032s1c1
Sequence:CCGGGCGGCCTTAATCCAGAGTTAACTCGAGTTAACTCTGGATTAAGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014112.1-1637s1c1
Sequence:CCGGCCGCTGTAAATTCTGCAATTTCTCGAGAAATTGCAGAATTTACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014112.2-3433s21c1
Sequence:CCGGACAACGGTGAGCAGATTATTACTCGAGTAATAATCTGCTCACCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014112.2-9791s21c1
Sequence:CCGGTACTAGAATGTTGGCTATAATCTCGAGATTATAGCCAACATTCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014112.2-2170s21c1
Sequence:CCGGATATGGTAACGAGCTATAATTCTCGAGAATTATAGCTCGTTACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014112.2-1851s21c1
Sequence:CCGGGGGTACTCAGTGCCCATAAAGCTCGAGCTTTATGGGCACTGAGTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014112.2-1647s21c1
Sequence:CCGGGGCAACTCATCCACCGAATTACTCGAGTAATTCGGTGGATGAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks