EMAIL THIS PAGE TO A FRIEND

TRPT1

tRNA phosphotransferase 1

UniProtKB ID: Q86TN4, A8MU17, A8MYC9, F5H2B2, Q9BSB9
Gene ID:
Mouse(107328) tRNA phosphotransferase 1
Rat(293704) tRNA phosphotransferase 1
naked mole-rat(101701513) tRNA phosphotransferase 1
domestic guinea pig(100733030) tRNA phosphotransferase 1
cow(510729) tRNA phosphotransferase 1
sheep(101122992) tRNA phosphotransferase 1
Zebrafish(503604) tRNA phosphotransferase 1
domestic cat(101091731) tRNA phosphotransferase 1
dog(483765) tRNA phosphotransferase 1
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031472 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033678 Rosetta Predictions human pricing
NM_031472 Rosetta Predictions human pricing
NM_001106331 Rosetta Predictions rat pricing
NM_153597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199584 predicted 360
2 SASI_Hs01_00199585 predicted 480
3 SASI_Hs01_00199586 predicted 537
4 SASI_Hs01_00199587 predicted 545
5 SASI_Hs01_00199588 predicted 545
6 SASI_Hs01_00199589 predicted 248
7 SASI_Hs01_00199590 predicted 555
8 SASI_Hs01_00199591 predicted 466
9 SASI_Hs01_00199592 predicted 450
10 SASI_Hs01_00199593 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119982 predicted 521
2 SASI_Hs01_00119983 predicted 219
3 SASI_Hs01_00119984 predicted 436
4 SASI_Hs01_00119985 predicted 338
5 SASI_Hs01_00119986 predicted 246
6 SASI_Hs01_00119987 predicted 455
7 SASI_Hs01_00119988 predicted 395
8 SASI_Hs01_00119989 predicted 530
9 SASI_Hs01_00119990 predicted 403
10 SASI_Hs01_00119991 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217918 predicted 1435
2 SASI_Rn02_00217919 predicted 753
3 SASI_Rn02_00217920 predicted 860
4 SASI_Rn02_00217921 predicted 724
5 SASI_Rn02_00217922 predicted 1558
6 SASI_Rn02_00217923 predicted 1546
7 SASI_Rn02_00217924 predicted 392
8 SASI_Rn02_00217925 predicted 811
9 SASI_Rn02_00217926 predicted 1564
10 SASI_Rn02_00217927 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071911 predicted 490
2 SASI_Mm01_00071912 predicted 414
3 SASI_Mm01_00071913 predicted 611
4 SASI_Mm01_00071914 predicted 704
5 SASI_Mm01_00071915 predicted 673
6 SASI_Mm01_00071916 predicted 428
7 SASI_Mm01_00071917 predicted 341
8 SASI_Mm01_00071918 predicted 565
9 SASI_Mm01_00071919 predicted 560
10 SASI_Mm01_00071920 predicted 604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031472
TRPT1 MISSION shRNA Bacterial Glycerol Stock
tRNA phosphotransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031472.3-684s21c1
Sequence:CCGGTGGCAGATGGAATACCCTTCTCTCGAGAGAAGGGTATTCCATCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031472.3-872s21c1
Sequence:CCGGAGGAGGAGGATCCAACAATAACTCGAGTTATTGTTGGATCCTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031472.3-361s21c1
Sequence:CCGGCGTGGTGGACACCAATAGGAACTCGAGTTCCTATTGGTGTCCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-539s1c1
Sequence:CCGGCCATTGTGAAATAGCTGTGTTCTCGAGAACACAGCTATTTCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-629s1c1
Sequence:CCGGTCCAGGGAATACTGATGGCTTCTCGAGAAGCCATCAGTATTCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-435s1c1
Sequence:CCGGTGGCCATCCATCCTACTCAAACTCGAGTTTGAGTAGGATGGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-650s1c1
Sequence:CCGGCCTCCTTCCCAAGTACTTCAACTCGAGTTGAAGTACTTGGGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-403s1c1
Sequence:CCGGCGATGCTAGTCCATGGTACATCTCGAGATGTACCATGGACTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031472
TRPT1 MISSION shRNA shRNA Plasmid DNA
tRNA phosphotransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031472.3-684s21c1
Sequence:CCGGTGGCAGATGGAATACCCTTCTCTCGAGAGAAGGGTATTCCATCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031472.3-872s21c1
Sequence:CCGGAGGAGGAGGATCCAACAATAACTCGAGTTATTGTTGGATCCTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031472.3-361s21c1
Sequence:CCGGCGTGGTGGACACCAATAGGAACTCGAGTTCCTATTGGTGTCCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-539s1c1
Sequence:CCGGCCATTGTGAAATAGCTGTGTTCTCGAGAACACAGCTATTTCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-629s1c1
Sequence:CCGGTCCAGGGAATACTGATGGCTTCTCGAGAAGCCATCAGTATTCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-435s1c1
Sequence:CCGGTGGCCATCCATCCTACTCAAACTCGAGTTTGAGTAGGATGGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-650s1c1
Sequence:CCGGCCTCCTTCCCAAGTACTTCAACTCGAGTTGAAGTACTTGGGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-403s1c1
Sequence:CCGGCGATGCTAGTCCATGGTACATCTCGAGATGTACCATGGACTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031472
TRPT1 MISSION shRNA Lentiviral Transduction Particles
tRNA phosphotransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031472.3-684s21c1
Sequence:CCGGTGGCAGATGGAATACCCTTCTCTCGAGAGAAGGGTATTCCATCTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031472.3-872s21c1
Sequence:CCGGAGGAGGAGGATCCAACAATAACTCGAGTTATTGTTGGATCCTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031472.3-361s21c1
Sequence:CCGGCGTGGTGGACACCAATAGGAACTCGAGTTCCTATTGGTGTCCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-539s1c1
Sequence:CCGGCCATTGTGAAATAGCTGTGTTCTCGAGAACACAGCTATTTCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-629s1c1
Sequence:CCGGTCCAGGGAATACTGATGGCTTCTCGAGAAGCCATCAGTATTCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-435s1c1
Sequence:CCGGTGGCCATCCATCCTACTCAAACTCGAGTTTGAGTAGGATGGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-650s1c1
Sequence:CCGGCCTCCTTCCCAAGTACTTCAACTCGAGTTGAAGTACTTGGGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031472.2-403s1c1
Sequence:CCGGCGATGCTAGTCCATGGTACATCTCGAGATGTACCATGGACTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153597
VALIDATED
TRPT1 MISSION shRNA Bacterial Glycerol Stock
tRNA phosphotransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-491s1c1
Sequence:CCGGCCTTGACACTAGTCCATGGTACTCGAGTACCATGGACTAGTGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-663s1c1
Sequence:CCGGCCTAGCCCTCACAGATGGAATCTCGAGATTCCATCTGTGAGGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153597.1-614s1c1
Sequence:CCGGTCAGCGGCATTCGTCCAAATTCTCGAGAATTTGGACGAATGCCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-347s1c1
Sequence:CCGGTCGTGGTCAATACCAACGAAACTCGAGTTTCGTTGGTATTGACCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-668s1c1
Sequence:CCGGCCCTCACAGATGGAATCCCTTCTCGAGAAGGGATTCCATCTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153597
VALIDATED
TRPT1 MISSION shRNA shRNA Plasmid DNA
tRNA phosphotransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-491s1c1
Sequence:CCGGCCTTGACACTAGTCCATGGTACTCGAGTACCATGGACTAGTGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-663s1c1
Sequence:CCGGCCTAGCCCTCACAGATGGAATCTCGAGATTCCATCTGTGAGGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153597.1-614s1c1
Sequence:CCGGTCAGCGGCATTCGTCCAAATTCTCGAGAATTTGGACGAATGCCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-347s1c1
Sequence:CCGGTCGTGGTCAATACCAACGAAACTCGAGTTTCGTTGGTATTGACCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-668s1c1
Sequence:CCGGCCCTCACAGATGGAATCCCTTCTCGAGAAGGGATTCCATCTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153597
VALIDATED
TRPT1 MISSION shRNA Lentiviral Transduction Particles
tRNA phosphotransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-491s1c1
Sequence:CCGGCCTTGACACTAGTCCATGGTACTCGAGTACCATGGACTAGTGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-663s1c1
Sequence:CCGGCCTAGCCCTCACAGATGGAATCTCGAGATTCCATCTGTGAGGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153597.1-614s1c1
Sequence:CCGGTCAGCGGCATTCGTCCAAATTCTCGAGAATTTGGACGAATGCCGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-347s1c1
Sequence:CCGGTCGTGGTCAATACCAACGAAACTCGAGTTTCGTTGGTATTGACCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153597.1-668s1c1
Sequence:CCGGCCCTCACAGATGGAATCCCTTCTCGAGAAGGGATTCCATCTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks