EMAIL THIS PAGE TO A FRIEND

TRPV1

transient receptor potential cation channel, subfamily V, member 1

Synonyms: VR1
Gene ID:
Human(7442) Summary: Capsaicin, the main pungent ingredient in hot chili peppers, elicits a sensation of burning pain by selectively activating sensory neurons that convey information about noxious stimuli to the central nervous system. The protein encoded by this gene is a receptor for capsaicin and is a non-selective cation channel that is structurally related to members of the TRP family of ion channels. This receptor is also activated by increases in temperature in the noxious range, suggesting that it functions as a transducer of painful thermal stimuli in vivo. Four transcript variants encoding the same protein, but with different 5' UTR sequence, have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(193034) transient receptor potential cation channel, subfamily V, member 1
Rat(83810) transient receptor potential cation channel, subfamily V, member 1
Zebrafish(561195) transient receptor potential cation channel, subfamily V, member 1
chicken(395259) transient receptor potential cation channel, subfamily V, member 1
dog(445457) transient receptor potential cation channel, subfamily V, member 1
domestic cat(101093406) transient receptor potential cation channel, subfamily V, member 1
Horse(100034158) transient receptor potential cation channel, subfamily V, member 1
domestic cat(100303454) transient receptor potential cation channel, subfamily V, member 1
cow(539074) transient receptor potential cation channel, subfamily V, member 1
sheep(101110158) transient receptor potential cation channel, subfamily V, member 1
domestic guinea pig(100135466) transient receptor potential cation channel, subfamily V, member 1
naked mole-rat(101720480) transient receptor potential cation channel, subfamily V, member 1
Domestic Rabbit(100008926) transient receptor potential cation channel, subfamily V, member 1
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
O0257 Olvanil powder human pricing
R8756 Resiniferatoxin from Euphorbia poisonii, ~95% rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
C191 Capsazepine ≥98% (HPLC), solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018727 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018727 Rosetta Predictions human pricing
NM_080704 Rosetta Predictions human pricing
NM_080705 Rosetta Predictions human pricing
NM_080706 Rosetta Predictions human pricing
NM_031982 Rosetta Predictions rat pricing
NM_001001445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053209 predicted 1204
2 SASI_Hs01_00053210 predicted 1843
3 SASI_Hs01_00053211 predicted 1062
4 SASI_Hs01_00053212 predicted 1760
5 SASI_Hs01_00053213 predicted 1940
6 SASI_Hs01_00053214 predicted 1038
7 SASI_Hs01_00053215 predicted 2208
8 SASI_Hs01_00053216 predicted 1961
9 SASI_Hs01_00053217 predicted 505
10 SASI_Hs02_00352272 predicted 887
11 SASI_Hs01_00053208 predicted 2158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056476 predicted 1323
2 SASI_Hs01_00056477 predicted 1955
3 SASI_Hs01_00056478 predicted 1173
4 SASI_Hs01_00056479 predicted 1880
5 SASI_Hs01_00056480 predicted 2057
6 SASI_Hs01_00056481 predicted 1158
7 SASI_Hs01_00056482 predicted 2330
8 SASI_Hs01_00056483 predicted 2074
9 SASI_Hs01_00056484 predicted 619
10 SASI_Hs02_00362490 predicted 1004
11 SASI_Hs01_00056475 predicted 2277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110692 predicted 1251
2 SASI_Hs01_00110693 predicted 1880
3 SASI_Hs01_00110694 predicted 1103
4 SASI_Hs01_00110695 predicted 1804
5 SASI_Hs01_00110696 predicted 1984
6 SASI_Hs01_00110697 predicted 1088
7 SASI_Hs01_00110698 predicted 2248
8 SASI_Hs01_00110699 predicted 2001
9 SASI_Hs01_00110700 predicted 548
10 SASI_Hs02_00362491 predicted 930
11 SASI_Hs01_00110691 predicted 2202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127016 predicted 1575
2 SASI_Hs01_00127017 predicted 2207
3 SASI_Hs01_00127018 predicted 1432
4 SASI_Hs01_00127019 predicted 2131
5 SASI_Hs01_00127020 predicted 2309
6 SASI_Hs01_00127021 predicted 1406
7 SASI_Hs01_00127022 predicted 2583
8 SASI_Hs01_00127023 predicted 2335
9 SASI_Hs01_00127024 predicted 865
10 SASI_Hs02_00362492 predicted 1250
11 SASI_Hs01_00127015 predicted 2520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032074 predicted 1767
2 SASI_Rn01_00032075 predicted 1353
3 SASI_Rn01_00032076 predicted 2063
4 SASI_Rn01_00032077 predicted 1867
5 SASI_Rn01_00032078 predicted 1763
6 SASI_Rn01_00032079 predicted 539
7 SASI_Rn01_00032080 predicted 972
8 SASI_Rn01_00032081 predicted 1126
9 SASI_Rn01_00032082 predicted 1388
10 SASI_Rn01_00032083 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041084 predicted 1277
2 SASI_Mm01_00041085 predicted 1987
3 SASI_Mm01_00041086 predicted 2080
4 SASI_Mm01_00041087 predicted 1953
5 SASI_Mm01_00041088 predicted 1516
6 SASI_Mm01_00041089 predicted 1155
7 SASI_Mm01_00041090 predicted 1314
8 SASI_Mm01_00041091 predicted 1408
9 SASI_Mm01_00041092 predicted 1674
10 SASI_Mm01_00041093 predicted 1696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001445
TRPV1 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-484s1c1
Sequence:CCGGGCCATGCTCAATCTGCACAATCTCGAGATTGTGCAGATTGAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-1755s1c1
Sequence:CCGGCCTCGTGTTCTTGTTTGGATTCTCGAGAATCCAAACAAGAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-964s1c1
Sequence:CCGGCCCACACTGAAGCTAGAAGAACTCGAGTTCTTCTAGCTTCAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-1504s1c1
Sequence:CCGGCCATCCCTCAAGAGTTTGTTTCTCGAGAAACAAACTCTTGAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-1972s1c1
Sequence:CCGGGCTGTCTTCATCATCCTGTTACTCGAGTAACAGGATGATGAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001445
TRPV1 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-484s1c1
Sequence:CCGGGCCATGCTCAATCTGCACAATCTCGAGATTGTGCAGATTGAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-1755s1c1
Sequence:CCGGCCTCGTGTTCTTGTTTGGATTCTCGAGAATCCAAACAAGAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-964s1c1
Sequence:CCGGCCCACACTGAAGCTAGAAGAACTCGAGTTCTTCTAGCTTCAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-1504s1c1
Sequence:CCGGCCATCCCTCAAGAGTTTGTTTCTCGAGAAACAAACTCTTGAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-1972s1c1
Sequence:CCGGGCTGTCTTCATCATCCTGTTACTCGAGTAACAGGATGATGAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001445
TRPV1 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-484s1c1
Sequence:CCGGGCCATGCTCAATCTGCACAATCTCGAGATTGTGCAGATTGAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-1755s1c1
Sequence:CCGGCCTCGTGTTCTTGTTTGGATTCTCGAGAATCCAAACAAGAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-964s1c1
Sequence:CCGGCCCACACTGAAGCTAGAAGAACTCGAGTTCTTCTAGCTTCAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-1504s1c1
Sequence:CCGGCCATCCCTCAAGAGTTTGTTTCTCGAGAAACAAACTCTTGAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001445.1-1972s1c1
Sequence:CCGGGCTGTCTTCATCATCCTGTTACTCGAGTAACAGGATGATGAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018727
TRPV1 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-1892s1c1
Sequence:CCGGCCGTTTCATGTTTGTCTACATCTCGAGATGTAGACAAACATGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-1454s1c1
Sequence:CCGGGCGCATCTTCTACTTCAACTTCTCGAGAAGTTGAAGTAGAAGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-1142s1c1
Sequence:CCGGGCTCACCAACAAGAAGGGAATCTCGAGATTCCCTTCTTGTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-2592s1c1
Sequence:CCGGGAAGTTTATCTGCGACAGTTTCTCGAGAAACTGTCGCAGATAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-525s1c1
Sequence:CCGGGCTCAGAATAACTGCCAGGATCTCGAGATCCTGGCAGTTATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018727
TRPV1 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-1892s1c1
Sequence:CCGGCCGTTTCATGTTTGTCTACATCTCGAGATGTAGACAAACATGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-1454s1c1
Sequence:CCGGGCGCATCTTCTACTTCAACTTCTCGAGAAGTTGAAGTAGAAGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-1142s1c1
Sequence:CCGGGCTCACCAACAAGAAGGGAATCTCGAGATTCCCTTCTTGTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-2592s1c1
Sequence:CCGGGAAGTTTATCTGCGACAGTTTCTCGAGAAACTGTCGCAGATAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-525s1c1
Sequence:CCGGGCTCAGAATAACTGCCAGGATCTCGAGATCCTGGCAGTTATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018727
TRPV1 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-1892s1c1
Sequence:CCGGCCGTTTCATGTTTGTCTACATCTCGAGATGTAGACAAACATGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-1454s1c1
Sequence:CCGGGCGCATCTTCTACTTCAACTTCTCGAGAAGTTGAAGTAGAAGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-1142s1c1
Sequence:CCGGGCTCACCAACAAGAAGGGAATCTCGAGATTCCCTTCTTGTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-2592s1c1
Sequence:CCGGGAAGTTTATCTGCGACAGTTTCTCGAGAAACTGTCGCAGATAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018727.3-525s1c1
Sequence:CCGGGCTCAGAATAACTGCCAGGATCTCGAGATCCTGGCAGTTATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks