EMAIL THIS PAGE TO A FRIEND

TRPV2

transient receptor potential cation channel, subfamily V, member 2

Synonyms: VRL VRL-1 VRL1
UniProtKB ID: Q9Y5S1, A6NML2, A8K0Z0, Q9Y670
Gene ID:
Human(51393) Summary: This gene encodes an ion channel that is activated by high temperatures above 52 degrees Celsius. The protein may be involved in transduction of high-temperature heat responses in sensory ganglia. It is thought that in other tissues the channel may be activated by stimuli other than heat. [provided by RefSeq, Jul 2008]
Mouse(22368) transient receptor potential cation channel, subfamily V, member 2
Rat(29465) transient receptor potential cation channel, subfamily V, member 2
Domestic Rabbit(100354812) transient receptor potential cation channel, subfamily V, member 2
naked mole-rat(101704733) transient receptor potential cation channel, subfamily V, member 2
cow(507664) transient receptor potential cation channel, subfamily V, member 2
sheep(101117259) transient receptor potential cation channel, subfamily V, member 2
chicken(417603) transient receptor potential cation channel, subfamily V, member 2
dog(489522) transient receptor potential cation channel, subfamily V, member 2
domestic cat(101093972) transient receptor potential cation channel, subfamily V, member 2
Horse(100063195) transient receptor potential cation channel, subfamily V, member 2
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016113 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014011 MISSION® esiRNA esiRNA targeting human TRPV2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016113 Rosetta Predictions human pricing
NM_017207 Rosetta Predictions rat pricing
NM_011706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148122 predicted 1732
2 SASI_Hs01_00148123 predicted 1426
3 SASI_Hs01_00148124 predicted 2386
4 SASI_Hs01_00148125 predicted 704
5 SASI_Hs01_00148126 predicted 1755
6 SASI_Hs01_00148128 predicted 2291
7 SASI_Hs01_00148129 predicted 1134
8 SASI_Hs01_00148131 predicted 1166
9 SASI_Hs02_00348881 predicted 1925
10 SASI_Hs02_00348882 predicted 815
11 SASI_Hs01_00148127 predicted 1637
12 SASI_Hs01_00148130 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033254 predicted 2283
2 SASI_Rn01_00033255 predicted 1509
3 SASI_Rn01_00033256 predicted 1140
4 SASI_Rn01_00033257 predicted 2497
5 SASI_Rn01_00033258 predicted 1994
6 SASI_Rn01_00033259 predicted 1271
7 SASI_Rn01_00033260 predicted 2260
8 SASI_Rn01_00033261 predicted 1744
9 SASI_Rn01_00033262 predicted 2457
10 SASI_Rn01_00033263 predicted 1908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176138 predicted 520
2 SASI_Mm02_00321267 predicted 1424
3 SASI_Mm01_00176139 predicted 1540
4 SASI_Mm01_00176140 predicted 2515
5 SASI_Mm01_00176141 predicted 1198
6 SASI_Mm01_00176142 predicted 1484
7 SASI_Mm01_00176143 predicted 1107
8 SASI_Mm01_00176144 predicted 1919
9 SASI_Mm02_00321268 predicted 2444
10 SASI_Mm02_00321269 predicted 2284
11 SASI_Mm01_00176137 predicted 1244
12 SASI_Mm01_00176145 predicted 2567
13 SASI_Mm01_00176146 predicted 1212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016113
TRPV2 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-2372s1c1
Sequence:CCGGCTGGAGATGGAGAATGGCTATCTCGAGATAGCCATTCTCCATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-1120s1c1
Sequence:CCGGCCTAGTGATGATCTCGGACAACTCGAGTTGTCCGAGATCATCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-1540s1c1
Sequence:CCGGCTTCTTAAACTTCCTGTGTAACTCGAGTTACACAGGAAGTTTAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-1981s1c1
Sequence:CCGGCCTTCTGATCTACTTAGTCTTCTCGAGAAGACTAAGTAGATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016113.3-570s21c1
Sequence:CCGGAGCCGGATCCAAACCGATTTGCTCGAGCAAATCGGTTTGGATCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016113.3-744s21c1
Sequence:CCGGACCTTAAGGACGGAGTCAATGCTCGAGCATTGACTCCGTCCTTAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016113.3-1498s21c1
Sequence:CCGGCAAACTGCTGCAGGCGAAATGCTCGAGCATTTCGCCTGCAGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016113
TRPV2 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-2372s1c1
Sequence:CCGGCTGGAGATGGAGAATGGCTATCTCGAGATAGCCATTCTCCATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-1120s1c1
Sequence:CCGGCCTAGTGATGATCTCGGACAACTCGAGTTGTCCGAGATCATCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-1540s1c1
Sequence:CCGGCTTCTTAAACTTCCTGTGTAACTCGAGTTACACAGGAAGTTTAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-1981s1c1
Sequence:CCGGCCTTCTGATCTACTTAGTCTTCTCGAGAAGACTAAGTAGATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016113.3-570s21c1
Sequence:CCGGAGCCGGATCCAAACCGATTTGCTCGAGCAAATCGGTTTGGATCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016113.3-744s21c1
Sequence:CCGGACCTTAAGGACGGAGTCAATGCTCGAGCATTGACTCCGTCCTTAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016113.3-1498s21c1
Sequence:CCGGCAAACTGCTGCAGGCGAAATGCTCGAGCATTTCGCCTGCAGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016113
TRPV2 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-2372s1c1
Sequence:CCGGCTGGAGATGGAGAATGGCTATCTCGAGATAGCCATTCTCCATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-1120s1c1
Sequence:CCGGCCTAGTGATGATCTCGGACAACTCGAGTTGTCCGAGATCATCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-1540s1c1
Sequence:CCGGCTTCTTAAACTTCCTGTGTAACTCGAGTTACACAGGAAGTTTAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016113.3-1981s1c1
Sequence:CCGGCCTTCTGATCTACTTAGTCTTCTCGAGAAGACTAAGTAGATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016113.3-570s21c1
Sequence:CCGGAGCCGGATCCAAACCGATTTGCTCGAGCAAATCGGTTTGGATCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016113.3-744s21c1
Sequence:CCGGACCTTAAGGACGGAGTCAATGCTCGAGCATTGACTCCGTCCTTAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016113.3-1498s21c1
Sequence:CCGGCAAACTGCTGCAGGCGAAATGCTCGAGCATTTCGCCTGCAGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011706
TRPV2 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-1630s1c1
Sequence:CCGGCGCCTGTTACTTGGTCTACATCTCGAGATGTAGACCAAGTAACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-2088s1c1
Sequence:CCGGGCTTTGCTGTAGCCCTAGTAACTCGAGTTACTAGGGCTACAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-1609s1c1
Sequence:CCGGCCCAAGATTCTTCTTCAACTTCTCGAGAAGTTGAAGAAGAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-2501s1c1
Sequence:CCGGCTGCTGAAAGTTGGCACCAAACTCGAGTTTGGTGCCAACTTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-1045s1c1
Sequence:CCGGCCAAGGAACTTGTTTCTATTTCTCGAGAAATAGAAACAAGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011706.2-1880s21c1
Sequence:CCGGGCTGGCTGAACCTGCTTTATTCTCGAGAATAAAGCAGGTTCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011706.2-1102s21c1
Sequence:CCGGGTCCTGCATGCTCTGGTAATGCTCGAGCATTACCAGAGCATGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011706.2-1750s21c1
Sequence:CCGGATCTCGTTCATGGACAGTTACCTCGAGGTAACTGTCCATGAACGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011706
TRPV2 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-1630s1c1
Sequence:CCGGCGCCTGTTACTTGGTCTACATCTCGAGATGTAGACCAAGTAACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-2088s1c1
Sequence:CCGGGCTTTGCTGTAGCCCTAGTAACTCGAGTTACTAGGGCTACAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-1609s1c1
Sequence:CCGGCCCAAGATTCTTCTTCAACTTCTCGAGAAGTTGAAGAAGAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-2501s1c1
Sequence:CCGGCTGCTGAAAGTTGGCACCAAACTCGAGTTTGGTGCCAACTTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-1045s1c1
Sequence:CCGGCCAAGGAACTTGTTTCTATTTCTCGAGAAATAGAAACAAGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011706.2-1880s21c1
Sequence:CCGGGCTGGCTGAACCTGCTTTATTCTCGAGAATAAAGCAGGTTCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011706.2-1102s21c1
Sequence:CCGGGTCCTGCATGCTCTGGTAATGCTCGAGCATTACCAGAGCATGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011706.2-1750s21c1
Sequence:CCGGATCTCGTTCATGGACAGTTACCTCGAGGTAACTGTCCATGAACGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011706
TRPV2 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-1630s1c1
Sequence:CCGGCGCCTGTTACTTGGTCTACATCTCGAGATGTAGACCAAGTAACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-2088s1c1
Sequence:CCGGGCTTTGCTGTAGCCCTAGTAACTCGAGTTACTAGGGCTACAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-1609s1c1
Sequence:CCGGCCCAAGATTCTTCTTCAACTTCTCGAGAAGTTGAAGAAGAATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-2501s1c1
Sequence:CCGGCTGCTGAAAGTTGGCACCAAACTCGAGTTTGGTGCCAACTTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011706.1-1045s1c1
Sequence:CCGGCCAAGGAACTTGTTTCTATTTCTCGAGAAATAGAAACAAGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011706.2-1880s21c1
Sequence:CCGGGCTGGCTGAACCTGCTTTATTCTCGAGAATAAAGCAGGTTCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011706.2-1102s21c1
Sequence:CCGGGTCCTGCATGCTCTGGTAATGCTCGAGCATTACCAGAGCATGCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011706.2-1750s21c1
Sequence:CCGGATCTCGTTCATGGACAGTTACCTCGAGGTAACTGTCCATGAACGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks