EMAIL THIS PAGE TO A FRIEND

TRPV3

transient receptor potential cation channel, subfamily V, member 3

Synonyms: OLMS VRL3
UniProtKB ID: Q8NET8, Q8NDW7, Q8NET9, Q8NFH2
Gene ID:
Human(162514) Summary: This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(246788) transient receptor potential cation channel, subfamily V, member 3
Rat(497948) transient receptor potential cation channel, subfamily V, member 3
chicken(771945) transient receptor potential cation channel, subfamily V, member 3
dog(491218) transient receptor potential cation channel, subfamily V, member 3
domestic cat(101093973) transient receptor potential cation channel, subfamily V, member 3
cow(523538) transient receptor potential cation channel, subfamily V, member 3
sheep(101121868) transient receptor potential cation channel, subfamily V, member 3
domestic guinea pig(100729354) transient receptor potential cation channel, subfamily V, member 3
naked mole-rat(101719293) transient receptor potential cation channel, subfamily V, member 3
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145068 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121471 MISSION® esiRNA esiRNA human TRPV3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145068 Rosetta Predictions human pricing
NM_001025757 Rosetta Predictions rat pricing
NM_145099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213533 predicted 2082
2 SASI_Hs01_00213534 predicted 1601
3 SASI_Hs01_00213535 predicted 2298
4 SASI_Hs01_00213536 predicted 1929
5 SASI_Hs01_00213537 predicted 1174
6 SASI_Hs01_00213538 predicted 1528
7 SASI_Hs01_00213539 predicted 1270
8 SASI_Hs01_00213540 predicted 1282
9 SASI_Hs01_00213541 predicted 2643
10 SASI_Hs01_00213542 predicted 1908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203426 predicted 1235
2 SASI_Rn01_00052918 predicted 463
3 SASI_Rn01_00052919 predicted 1052
4 SASI_Rn01_00052920 predicted 783
5 SASI_Rn02_00203427 predicted 1885
6 SASI_Rn01_00052921 predicted 2078
7 SASI_Rn01_00052922 predicted 2228
8 SASI_Rn01_00052923 predicted 2304
9 SASI_Rn01_00052924 predicted 1106
10 SASI_Rn01_00052925 predicted 1802
11 SASI_Rn01_00052926 predicted 1600
12 SASI_Rn01_00052927 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340497 predicted 1679
2 SASI_Mm01_00062275 predicted 1618
3 SASI_Mm01_00062276 predicted 1648
4 SASI_Mm01_00062277 predicted 922
5 SASI_Mm01_00062278 predicted 1843
6 SASI_Mm01_00062279 predicted 1122
7 SASI_Mm01_00062280 predicted 1223
8 SASI_Mm01_00062281 predicted 2193
9 SASI_Mm01_00062282 predicted 998
10 SASI_Mm01_00062283 predicted 1017
11 SASI_Mm01_00062284 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145068
TRPV3 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145068.2-2552s21c1
Sequence:CCGGACGCACGTCTCCTTCCTTAACCTCGAGGTTAAGGAAGGAGACGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145068.2-1998s21c1
Sequence:CCGGGGGCGAACATGCTCTACTATACTCGAGTATAGTAGAGCATGTTCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-1802s1c1
Sequence:CCGGGCCATGTGCATCTCTGTGAAACTCGAGTTTCACAGAGATGCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-2116s1c1
Sequence:CCGGGCTTGGATTTGGAGTAGCCTTCTCGAGAAGGCTACTCCAAATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-1531s1c1
Sequence:CCGGGCTGGAAATCACTGTCTACAACTCGAGTTGTAGACAGTGATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-1606s1c1
Sequence:CCGGGCTGCATATGAAGTGGAAGAACTCGAGTTCTTCCACTTCATATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-443s1c1
Sequence:CCGGGCACACTTCTTCCTGGAGATACTCGAGTATCTCCAGGAAGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145068
TRPV3 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145068.2-2552s21c1
Sequence:CCGGACGCACGTCTCCTTCCTTAACCTCGAGGTTAAGGAAGGAGACGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145068.2-1998s21c1
Sequence:CCGGGGGCGAACATGCTCTACTATACTCGAGTATAGTAGAGCATGTTCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-1802s1c1
Sequence:CCGGGCCATGTGCATCTCTGTGAAACTCGAGTTTCACAGAGATGCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-2116s1c1
Sequence:CCGGGCTTGGATTTGGAGTAGCCTTCTCGAGAAGGCTACTCCAAATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-1531s1c1
Sequence:CCGGGCTGGAAATCACTGTCTACAACTCGAGTTGTAGACAGTGATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-1606s1c1
Sequence:CCGGGCTGCATATGAAGTGGAAGAACTCGAGTTCTTCCACTTCATATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-443s1c1
Sequence:CCGGGCACACTTCTTCCTGGAGATACTCGAGTATCTCCAGGAAGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145068
TRPV3 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145068.2-2552s21c1
Sequence:CCGGACGCACGTCTCCTTCCTTAACCTCGAGGTTAAGGAAGGAGACGTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145068.2-1998s21c1
Sequence:CCGGGGGCGAACATGCTCTACTATACTCGAGTATAGTAGAGCATGTTCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-1802s1c1
Sequence:CCGGGCCATGTGCATCTCTGTGAAACTCGAGTTTCACAGAGATGCACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-2116s1c1
Sequence:CCGGGCTTGGATTTGGAGTAGCCTTCTCGAGAAGGCTACTCCAAATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-1531s1c1
Sequence:CCGGGCTGGAAATCACTGTCTACAACTCGAGTTGTAGACAGTGATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-1606s1c1
Sequence:CCGGGCTGCATATGAAGTGGAAGAACTCGAGTTCTTCCACTTCATATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145068.2-443s1c1
Sequence:CCGGGCACACTTCTTCCTGGAGATACTCGAGTATCTCCAGGAAGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145099
TRPV3 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000068858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-1273s1c1
Sequence:CCGGGCTGGAAATCATCGTCTACAACTCGAGTTGTAGACGATGATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-130s1c1
Sequence:CCGGCCCTGTTGTACTGACAGAGAACTCGAGTTCTCTGTCAGTACAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-1825s1c1
Sequence:CCGGCCTCAAGTTCTTGTTTGTTTACTCGAGTAAACAAACAAGAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-1622s1c1
Sequence:CCGGGCCTGGTTTCACTTTGTCTTTCTCGAGAAAGACAAAGTGAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145099
TRPV3 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000068858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-1273s1c1
Sequence:CCGGGCTGGAAATCATCGTCTACAACTCGAGTTGTAGACGATGATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-130s1c1
Sequence:CCGGCCCTGTTGTACTGACAGAGAACTCGAGTTCTCTGTCAGTACAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-1825s1c1
Sequence:CCGGCCTCAAGTTCTTGTTTGTTTACTCGAGTAAACAAACAAGAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-1622s1c1
Sequence:CCGGGCCTGGTTTCACTTTGTCTTTCTCGAGAAAGACAAAGTGAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145099
TRPV3 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000068858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-1273s1c1
Sequence:CCGGGCTGGAAATCATCGTCTACAACTCGAGTTGTAGACGATGATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-130s1c1
Sequence:CCGGCCCTGTTGTACTGACAGAGAACTCGAGTTCTCTGTCAGTACAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-1825s1c1
Sequence:CCGGCCTCAAGTTCTTGTTTGTTTACTCGAGTAAACAAACAAGAACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145099.1-1622s1c1
Sequence:CCGGGCCTGGTTTCACTTTGTCTTTCTCGAGAAAGACAAAGTGAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks