EMAIL THIS PAGE TO A FRIEND

TRPV4

transient receptor potential cation channel, subfamily V, member 4

Synonyms: CMT2C HMSN2C OTRPC4 SMAL SPSMA SSQTL1 TRP12 VRL2 VROAC
Gene ID:
Human(59341) Summary: This gene encodes a member of the OSM9-like transient receptor potential channel (OTRPC) subfamily in the transient receptor potential (TRP) superfamily of ion channels. The encoded protein is a Ca2+-permeable, nonselective cation channel that is thought to be involved in the regulation of systemic osmotic pressure. Mutations in this gene are the cause of spondylometaphyseal and metatropic dysplasia and hereditary motor and sensory neuropathy type IIC. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Mouse(63873) transient receptor potential cation channel, subfamily V, member 4
Rat(66026) transient receptor potential cation channel, subfamily V, member 4
naked mole-rat(101706710) transient receptor potential cation channel, subfamily V, member 4
domestic guinea pig(100724607) transient receptor potential cation channel, subfamily V, member 4
cow(540259) transient receptor potential cation channel, subfamily V, member 4
sheep(101113534) transient receptor potential cation channel, subfamily V, member 4
Zebrafish(557850) transient receptor potential cation channel, subfamily V, member 4
chicken(395427) transient receptor potential cation channel, subfamily V, member 4
Horse(100066552) transient receptor potential cation channel, subfamily V, member 4
domestic cat(101084907) transient receptor potential cation channel, subfamily V, member 4
dog(486308) transient receptor potential cation channel, subfamily V, member 4
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
T9075 Anti-TRPV4 antibody produced in rabbit affinity isolated antibody, lyophilized powder rat
western blot pricing
SAB2104216 Anti-TRPV4 antibody produced in rabbit affinity isolated antibody bovine, rat, rabbit, pig, guinea pig, canine, human, mouse
western blot pricing
SAB2104243 Anti-TRPV4 antibody produced in rabbit affinity isolated antibody human, bovine, pig, rabbit, mouse, rat, guinea pig, canine
western blot pricing
SAB3501100 Anti-TRPV4 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
M1022 Dihydrocapsaicin from Capsicum sp., ≥85% human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
V9130 N-Vanillylnonanamide ≥97%, powder rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021625 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021625 Rosetta Predictions human pricing
NM_147204 Rosetta Predictions human pricing
NM_023970 Rosetta Predictions rat pricing
NM_022017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013361 predicted 980
2 SASI_Hs01_00013362 predicted 2485
3 SASI_Hs01_00013363 predicted 2455
4 SASI_Hs01_00013364 predicted 625
5 SASI_Hs01_00013366 predicted 618
6 SASI_Hs01_00013367 predicted 1652
7 SASI_Hs01_00013368 predicted 2181
8 SASI_Hs01_00013369 predicted 2733
9 SASI_Hs01_00013370 predicted 2490
10 SASI_Hs02_00354974 predicted 895
11 SASI_Hs01_00013365 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135734 predicted 981
2 SASI_Hs01_00135735 predicted 2306
3 SASI_Hs01_00135736 predicted 2276
4 SASI_Hs01_00135737 predicted 630
5 SASI_Hs01_00135739 predicted 617
6 SASI_Hs01_00135740 predicted 1474
7 SASI_Hs01_00135741 predicted 2002
8 SASI_Hs01_00135742 predicted 2550
9 SASI_Hs01_00135743 predicted 2305
10 SASI_Hs02_00365548 predicted 895
11 SASI_Hs01_00135738 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049816 predicted 1023
2 SASI_Rn01_00049817 predicted 1327
3 SASI_Rn01_00049818 predicted 1667
4 SASI_Rn01_00049819 predicted 1080
5 SASI_Rn01_00049820 predicted 1104
6 SASI_Rn01_00049822 predicted 1494
7 SASI_Rn01_00049823 predicted 351
8 SASI_Rn01_00049824 predicted 1001
9 SASI_Rn02_00263778 predicted 2434
10 SASI_Rn01_00049825 predicted 1092
11 SASI_Rn01_00049821 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182300 predicted 1720
2 SASI_Mm02_00326491 predicted 443
3 SASI_Mm01_00182301 predicted 1186
4 SASI_Mm01_00182302 predicted 738
5 SASI_Mm01_00182303 predicted 427
6 SASI_Mm01_00182304 predicted 1309
7 SASI_Mm01_00182305 predicted 1450
8 SASI_Mm01_00182307 predicted 1434
9 SASI_Mm01_00182308 predicted 2170
10 SASI_Mm01_00182309 predicted 985
11 SASI_Mm01_00182306 predicted 1204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021625
TRPV4 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-1325s1c1
Sequence:CCGGGCCAGTGTATTCCTCGCTTTACTCGAGTAAAGCGAGGAATACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-834s1c1
Sequence:CCGGCGCTGCAAACACTACGTGGAACTCGAGTTCCACGTAGTGTTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-408s1c1
Sequence:CCGGCTGTTTGACTACGGCACCTATCTCGAGATAGGTGCCGTAGTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-2007s1c1
Sequence:CCGGGCCAACATGAAGGTGTGCAATCTCGAGATTGCACACCTTCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-2456s1c1
Sequence:CCGGCCAGAACTTGGGCATCATCAACTCGAGTTGATGATGCCCAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021625.3-2908s21c1
Sequence:CCGGTGCTCCTATGGAGTCACATAACTCGAGTTATGTGACTCCATAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021625.3-2742s21c1
Sequence:CCGGTTTCTAGTCCAGCCGCATTTCCTCGAGGAAATGCGGCTGGACTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021625.3-1093s21c1
Sequence:CCGGCCCGTGAGAACACCAAGTTTGCTCGAGCAAACTTGGTGTTCTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021625
TRPV4 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-1325s1c1
Sequence:CCGGGCCAGTGTATTCCTCGCTTTACTCGAGTAAAGCGAGGAATACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-834s1c1
Sequence:CCGGCGCTGCAAACACTACGTGGAACTCGAGTTCCACGTAGTGTTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-408s1c1
Sequence:CCGGCTGTTTGACTACGGCACCTATCTCGAGATAGGTGCCGTAGTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-2007s1c1
Sequence:CCGGGCCAACATGAAGGTGTGCAATCTCGAGATTGCACACCTTCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-2456s1c1
Sequence:CCGGCCAGAACTTGGGCATCATCAACTCGAGTTGATGATGCCCAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021625.3-2908s21c1
Sequence:CCGGTGCTCCTATGGAGTCACATAACTCGAGTTATGTGACTCCATAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021625.3-2742s21c1
Sequence:CCGGTTTCTAGTCCAGCCGCATTTCCTCGAGGAAATGCGGCTGGACTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021625.3-1093s21c1
Sequence:CCGGCCCGTGAGAACACCAAGTTTGCTCGAGCAAACTTGGTGTTCTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021625
TRPV4 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-1325s1c1
Sequence:CCGGGCCAGTGTATTCCTCGCTTTACTCGAGTAAAGCGAGGAATACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-834s1c1
Sequence:CCGGCGCTGCAAACACTACGTGGAACTCGAGTTCCACGTAGTGTTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-408s1c1
Sequence:CCGGCTGTTTGACTACGGCACCTATCTCGAGATAGGTGCCGTAGTCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-2007s1c1
Sequence:CCGGGCCAACATGAAGGTGTGCAATCTCGAGATTGCACACCTTCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021625.3-2456s1c1
Sequence:CCGGCCAGAACTTGGGCATCATCAACTCGAGTTGATGATGCCCAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021625.3-2908s21c1
Sequence:CCGGTGCTCCTATGGAGTCACATAACTCGAGTTATGTGACTCCATAGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021625.3-2742s21c1
Sequence:CCGGTTTCTAGTCCAGCCGCATTTCCTCGAGGAAATGCGGCTGGACTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021625.3-1093s21c1
Sequence:CCGGCCCGTGAGAACACCAAGTTTGCTCGAGCAAACTTGGTGTTCTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022017
TRPV4 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-2473s1c1
Sequence:CCGGCCCTGGCAAGAGTGAAATCTACTCGAGTAGATTTCACTCTTGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-2212s1c1
Sequence:CCGGGAACATGCTTATCGCCCTCATCTCGAGATGAGGGCGATAAGCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-1162s1c1
Sequence:CCGGCCTGGAGACAGTTCTCAACAACTCGAGTTGTTGAGAACTGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-509s1c1
Sequence:CCGGCCCATCCTCAAAGTCTTCAATCTCGAGATTGAAGACTTTGAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-1645s1c1
Sequence:CCGGCCTGTTCTTCTTTACCAGTATCTCGAGATACTGGTAAAGAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022017
TRPV4 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-2473s1c1
Sequence:CCGGCCCTGGCAAGAGTGAAATCTACTCGAGTAGATTTCACTCTTGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-2212s1c1
Sequence:CCGGGAACATGCTTATCGCCCTCATCTCGAGATGAGGGCGATAAGCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-1162s1c1
Sequence:CCGGCCTGGAGACAGTTCTCAACAACTCGAGTTGTTGAGAACTGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-509s1c1
Sequence:CCGGCCCATCCTCAAAGTCTTCAATCTCGAGATTGAAGACTTTGAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-1645s1c1
Sequence:CCGGCCTGTTCTTCTTTACCAGTATCTCGAGATACTGGTAAAGAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022017
TRPV4 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-2473s1c1
Sequence:CCGGCCCTGGCAAGAGTGAAATCTACTCGAGTAGATTTCACTCTTGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-2212s1c1
Sequence:CCGGGAACATGCTTATCGCCCTCATCTCGAGATGAGGGCGATAAGCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-1162s1c1
Sequence:CCGGCCTGGAGACAGTTCTCAACAACTCGAGTTGTTGAGAACTGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-509s1c1
Sequence:CCGGCCCATCCTCAAAGTCTTCAATCTCGAGATTGAAGACTTTGAGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022017.1-1645s1c1
Sequence:CCGGCCTGTTCTTCTTTACCAGTATCTCGAGATACTGGTAAAGAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks