EMAIL THIS PAGE TO A FRIEND

TRPV5

transient receptor potential cation channel, subfamily V, member 5

Synonyms: CAT2 ECAC1 OTRPC3
UniProtKB ID: Q9NQA5, A4D2H7, Q8NDW5, Q8NDX7, Q8NDX8, Q96PM6
Gene ID:
Human(56302) Summary: This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level. [provided by RefSeq, Jul 2008]
Mouse(194352) transient receptor potential cation channel, subfamily V, member 5
Rat(116469) transient receptor potential cation channel, subfamily V, member 5
Horse(100034071) transient receptor potential cation channel, subfamily V, member 5
domestic cat(101098045) transient receptor potential cation channel, subfamily V, member 5
dog(482744) transient receptor potential cation channel, subfamily V, member 5
cow(524365) transient receptor potential cation channel, subfamily V, member 5
sheep(101120825) transient receptor potential cation channel, subfamily V, member 5
Domestic Rabbit(100009364) transient receptor potential cation channel, subfamily V, member 5
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_112633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_112633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_112633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019841 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019841 Rosetta Predictions human pricing
NM_053787 Rosetta Predictions rat pricing
NM_001007572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244584 predicted 1260
2 SASI_Hs01_00244585 predicted 1382
3 SASI_Hs01_00244586 predicted 434
4 SASI_Hs01_00244587 predicted 1770
5 SASI_Hs01_00244588 predicted 2195
6 SASI_Hs01_00244589 predicted 1722
7 SASI_Hs02_00352850 predicted 362
8 SASI_Hs01_00244590 predicted 1768
9 SASI_Hs01_00244591 predicted 1268
10 SASI_Hs01_00244593 predicted 445
11 SASI_Hs01_00244592 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103580 predicted 1774
2 SASI_Rn01_00103581 predicted 2246
3 SASI_Rn01_00103582 predicted 1985
4 SASI_Rn01_00103583 predicted 2027
5 SASI_Rn02_00266593 predicted 2311
6 SASI_Rn01_00103584 predicted 2256
7 SASI_Rn01_00103585 predicted 2075
8 SASI_Rn01_00103586 predicted 1636
9 SASI_Rn01_00103587 predicted 447
10 SASI_Rn01_00103588 predicted 1326
11 SASI_Rn01_00103589 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286750 predicted 2321
2 SASI_Mm01_00136873 predicted 946
3 SASI_Mm01_00136874 predicted 512
4 SASI_Mm02_00286751 predicted 2150
5 SASI_Mm01_00136876 predicted 1967
6 SASI_Mm01_00136877 predicted 354
7 SASI_Mm01_00136878 predicted 1954
8 SASI_Mm01_00136879 predicted 1005
9 SASI_Mm02_00286752 predicted 1288
10 SASI_Mm01_00136882 predicted 1170
11 SASI_Mm01_00136875 predicted 739
12 SASI_Mm01_00136880 predicted 736
13 SASI_Mm01_00136881 predicted 1474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_112633
TRPV5 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-1933s1c1
Sequence:CCGGCCTGCCAATTACAGAGTGGATCTCGAGATCCACTCTGTAATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-2185s1c1
Sequence:CCGGCGTTGGTTCTTACGGGTTGAACTCGAGTTCAACCCGTAAGAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-1387s1c1
Sequence:CCGGGCTGTAATTATTCTACTCCTACTCGAGTAGGAGTAGAATAATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-1693s1c1
Sequence:CCGGGCTATGGTCATCCTGGGATTTCTCGAGAAATCCCAGGATGACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-108s1c1
Sequence:CCGGCGTGAACTCAACAATGGGTATCTCGAGATACCCATTGTTGAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_112633
TRPV5 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-1933s1c1
Sequence:CCGGCCTGCCAATTACAGAGTGGATCTCGAGATCCACTCTGTAATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-2185s1c1
Sequence:CCGGCGTTGGTTCTTACGGGTTGAACTCGAGTTCAACCCGTAAGAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-1387s1c1
Sequence:CCGGGCTGTAATTATTCTACTCCTACTCGAGTAGGAGTAGAATAATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-1693s1c1
Sequence:CCGGGCTATGGTCATCCTGGGATTTCTCGAGAAATCCCAGGATGACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-108s1c1
Sequence:CCGGCGTGAACTCAACAATGGGTATCTCGAGATACCCATTGTTGAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_112633
TRPV5 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-1933s1c1
Sequence:CCGGCCTGCCAATTACAGAGTGGATCTCGAGATCCACTCTGTAATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-2185s1c1
Sequence:CCGGCGTTGGTTCTTACGGGTTGAACTCGAGTTCAACCCGTAAGAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-1387s1c1
Sequence:CCGGGCTGTAATTATTCTACTCCTACTCGAGTAGGAGTAGAATAATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-1693s1c1
Sequence:CCGGGCTATGGTCATCCTGGGATTTCTCGAGAAATCCCAGGATGACCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112633.3-108s1c1
Sequence:CCGGCGTGAACTCAACAATGGGTATCTCGAGATACCCATTGTTGAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019841
TRPV5 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019841.x-2619s1c1
Sequence:CCGGGTGTCTAACTTCTGTGCCTGTCTCGAGACAGGCACAGAAGTTAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1863s1c1
Sequence:CCGGCCTCCGCGTTCTATATCATTTCTCGAGAAATGATATAGAACGCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-2049s1c1
Sequence:CCGGCACTGCTCATGCTCAACTTGTCTCGAGACAAGTTGAGCATGAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1744s1c1
Sequence:CCGGCATGTATTTCACTCGAGGATTCTCGAGAATCCTCGAGTGAAATACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1357s1c1
Sequence:CCGGCCTGCTCTACATGATCTGCTTCTCGAGAAGCAGATCATGTAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1862s1c1
Sequence:CCGGGCCTCCGCGTTCTATATCATTCTCGAGAATGATATAGAACGCGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-2249s1c1
Sequence:CCGGGAGAACCACAATGATCAGAATCTCGAGATTCTGATCATTGTGGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019841
TRPV5 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019841.x-2619s1c1
Sequence:CCGGGTGTCTAACTTCTGTGCCTGTCTCGAGACAGGCACAGAAGTTAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1863s1c1
Sequence:CCGGCCTCCGCGTTCTATATCATTTCTCGAGAAATGATATAGAACGCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-2049s1c1
Sequence:CCGGCACTGCTCATGCTCAACTTGTCTCGAGACAAGTTGAGCATGAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1744s1c1
Sequence:CCGGCATGTATTTCACTCGAGGATTCTCGAGAATCCTCGAGTGAAATACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1357s1c1
Sequence:CCGGCCTGCTCTACATGATCTGCTTCTCGAGAAGCAGATCATGTAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1862s1c1
Sequence:CCGGGCCTCCGCGTTCTATATCATTCTCGAGAATGATATAGAACGCGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-2249s1c1
Sequence:CCGGGAGAACCACAATGATCAGAATCTCGAGATTCTGATCATTGTGGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019841
TRPV5 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019841.x-2619s1c1
Sequence:CCGGGTGTCTAACTTCTGTGCCTGTCTCGAGACAGGCACAGAAGTTAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1863s1c1
Sequence:CCGGCCTCCGCGTTCTATATCATTTCTCGAGAAATGATATAGAACGCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-2049s1c1
Sequence:CCGGCACTGCTCATGCTCAACTTGTCTCGAGACAAGTTGAGCATGAGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1744s1c1
Sequence:CCGGCATGTATTTCACTCGAGGATTCTCGAGAATCCTCGAGTGAAATACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1357s1c1
Sequence:CCGGCCTGCTCTACATGATCTGCTTCTCGAGAAGCAGATCATGTAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-1862s1c1
Sequence:CCGGGCCTCCGCGTTCTATATCATTCTCGAGAATGATATAGAACGCGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019841.x-2249s1c1
Sequence:CCGGGAGAACCACAATGATCAGAATCTCGAGATTCTGATCATTGTGGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks