EMAIL THIS PAGE TO A FRIEND

TRPV6

transient receptor potential cation channel, subfamily V, member 6

Synonyms: ABP/ZF CAT1 CATL ECAC2 HSA277909 LP6728 ZFAB
Gene ID:
Human(55503) Summary: This gene encodes a member of the vanilloid family of transient receptor potential (TRP) calcium channel proteins. Proteins in this TRP family have an N-terminal ankyrin repeat domain, which is required for channel assembly and regulation. [provided by RefSeq, Nov 2011]
Mouse(64177) transient receptor potential cation channel, subfamily V, member 6
Rat(114246) transient receptor potential cation channel, subfamily V, member 6
Domestic Rabbit(100009565) transient receptor potential cation channel, subfamily V, member 6
naked mole-rat(101717032) transient receptor potential cation channel, subfamily V, member 6
domestic guinea pig(100726682) transient receptor potential cation channel, subfamily V, member 6
cow(614878) transient receptor potential cation channel, subfamily V, member 6
Zebrafish(100000322) transient receptor potential cation channel, subfamily V, member 6
chicken(418307) transient receptor potential cation channel, subfamily V, member 6
dog(482745) transient receptor potential cation channel, subfamily V, member 6
Horse(100055509) transient receptor potential cation channel, subfamily V, member 6
domestic cat(101086218) transient receptor potential cation channel, subfamily V, member 6
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018646 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080971 MISSION® esiRNA esiRNA human TRPV6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018646 Rosetta Predictions human pricing
NM_053686 Rosetta Predictions rat pricing
NM_022413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186767 predicted 244
2 SASI_Hs01_00186768 predicted 355
3 SASI_Hs01_00186770 predicted 1215
4 SASI_Hs01_00186771 predicted 1310
5 SASI_Hs01_00186772 predicted 411
6 SASI_Hs01_00186773 predicted 260
7 SASI_Hs01_00186774 predicted 2459
8 SASI_Hs01_00186775 predicted 393
9 SASI_Hs01_00186776 predicted 548
10 SASI_Hs02_00352146 predicted 523
11 SASI_Hs01_00186769 predicted 2247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057504 predicted 659
2 SASI_Rn01_00057505 predicted 1150
3 SASI_Rn01_00057506 predicted 1795
4 SASI_Rn01_00057507 predicted 2075
5 SASI_Rn01_00057508 predicted 542
6 SASI_Rn01_00057510 predicted 2564
7 SASI_Rn01_00057511 predicted 2565
8 SASI_Rn01_00057512 predicted 2568
9 SASI_Rn01_00057513 predicted 1681
10 SASI_Rn02_00266429 predicted 2133
11 SASI_Rn01_00057509 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164051 predicted 744
2 SASI_Mm01_00164052 predicted 473
3 SASI_Mm01_00164053 predicted 1966
4 SASI_Mm01_00164054 predicted 2497
5 SASI_Mm01_00164055 predicted 580
6 SASI_Mm01_00164056 predicted 2303
7 SASI_Mm01_00164057 predicted 1713
8 SASI_Mm02_00326590 predicted 2494
9 SASI_Mm01_00164058 predicted 1451
10 SASI_Mm01_00164059 predicted 2082
11 SASI_Mm01_00164060 predicted 1072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018646
VALIDATED
TRPV6 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-2110s1c1
Sequence:CCGGCGGGTGGAAGACAGGCAAGATCTCGAGATCTTGCCTGTCTTCCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-2263s1c1
Sequence:CCGGTCAGTGTCTCGAAGTACCTCCCTCGAGGGAGGTACTTCGAGACACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-1598s1c1
Sequence:CCGGGCTGGTGCAACGTCATGTACTCTCGAGAGTACATGACGTTGCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-358s1c1
Sequence:CCGGCCTCTCCTTCTAGCTGCCAAACTCGAGTTTGGCAGCTAGAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018646.x-2856s1c1
Sequence:CCGGGCCAACTCCATCTTCAATAAACTCGAGTTTATTGAAGATGGAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018646.x-1230s1c1
Sequence:CCGGGTACATCATCTGCTTCACCATCTCGAGATGGTGAAGCAGATGATGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-1402s1c1
Sequence:CCGGGCTATCATCATCCTGCTGGTACTCGAGTACCAGCAGGATGATGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-1230s1c2
Sequence:CCGGGTACATCATCTGCTTCACCATCTCGAGATGGTGAAGCAGATGATGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-2329s21c1
Sequence:CCGGAGAGACCTGCGTGGGATAATCCTCGAGGATTATCCCACGCAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-2110s21c1
Sequence:CCGGCGGGTGGAAGACAGGCAAGATCTCGAGATCTTGCCTGTCTTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-1205s21c1
Sequence:CCGGGCATGCTGGGTGCCATATATCCTCGAGGATATATGGCACCCAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-1230s21c1
Sequence:CCGGGTACATCATCTGCTTCACCATCTCGAGATGGTGAAGCAGATGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018646.2-2415s21c1
Sequence:CCGGTCCTGGAACTTGCTCTCATTTCTCGAGAAATGAGAGCAAGTTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018646
VALIDATED
TRPV6 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-2110s1c1
Sequence:CCGGCGGGTGGAAGACAGGCAAGATCTCGAGATCTTGCCTGTCTTCCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-2263s1c1
Sequence:CCGGTCAGTGTCTCGAAGTACCTCCCTCGAGGGAGGTACTTCGAGACACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-1598s1c1
Sequence:CCGGGCTGGTGCAACGTCATGTACTCTCGAGAGTACATGACGTTGCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-358s1c1
Sequence:CCGGCCTCTCCTTCTAGCTGCCAAACTCGAGTTTGGCAGCTAGAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018646.x-2856s1c1
Sequence:CCGGGCCAACTCCATCTTCAATAAACTCGAGTTTATTGAAGATGGAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018646.x-1230s1c1
Sequence:CCGGGTACATCATCTGCTTCACCATCTCGAGATGGTGAAGCAGATGATGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-1402s1c1
Sequence:CCGGGCTATCATCATCCTGCTGGTACTCGAGTACCAGCAGGATGATGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-1230s1c2
Sequence:CCGGGTACATCATCTGCTTCACCATCTCGAGATGGTGAAGCAGATGATGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-2329s21c1
Sequence:CCGGAGAGACCTGCGTGGGATAATCCTCGAGGATTATCCCACGCAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-2110s21c1
Sequence:CCGGCGGGTGGAAGACAGGCAAGATCTCGAGATCTTGCCTGTCTTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-1205s21c1
Sequence:CCGGGCATGCTGGGTGCCATATATCCTCGAGGATATATGGCACCCAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-1230s21c1
Sequence:CCGGGTACATCATCTGCTTCACCATCTCGAGATGGTGAAGCAGATGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018646.2-2415s21c1
Sequence:CCGGTCCTGGAACTTGCTCTCATTTCTCGAGAAATGAGAGCAAGTTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018646
VALIDATED
TRPV6 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-2110s1c1
Sequence:CCGGCGGGTGGAAGACAGGCAAGATCTCGAGATCTTGCCTGTCTTCCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-2263s1c1
Sequence:CCGGTCAGTGTCTCGAAGTACCTCCCTCGAGGGAGGTACTTCGAGACACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-1598s1c1
Sequence:CCGGGCTGGTGCAACGTCATGTACTCTCGAGAGTACATGACGTTGCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-358s1c1
Sequence:CCGGCCTCTCCTTCTAGCTGCCAAACTCGAGTTTGGCAGCTAGAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018646.x-2856s1c1
Sequence:CCGGGCCAACTCCATCTTCAATAAACTCGAGTTTATTGAAGATGGAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_018646.x-1230s1c1
Sequence:CCGGGTACATCATCTGCTTCACCATCTCGAGATGGTGAAGCAGATGATGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-1402s1c1
Sequence:CCGGGCTATCATCATCCTGCTGGTACTCGAGTACCAGCAGGATGATGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018646.x-1230s1c2
Sequence:CCGGGTACATCATCTGCTTCACCATCTCGAGATGGTGAAGCAGATGATGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-2329s21c1
Sequence:CCGGAGAGACCTGCGTGGGATAATCCTCGAGGATTATCCCACGCAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-2110s21c1
Sequence:CCGGCGGGTGGAAGACAGGCAAGATCTCGAGATCTTGCCTGTCTTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-1205s21c1
Sequence:CCGGGCATGCTGGGTGCCATATATCCTCGAGGATATATGGCACCCAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018646.2-1230s21c1
Sequence:CCGGGTACATCATCTGCTTCACCATCTCGAGATGGTGAAGCAGATGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018646.2-2415s21c1
Sequence:CCGGTCCTGGAACTTGCTCTCATTTCTCGAGAAATGAGAGCAAGTTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022413
TRPV6 MISSION shRNA Bacterial Glycerol Stock
transient receptor potential cation channel, subfamily V, member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-914s1c1
Sequence:CCGGCCCTGGAACTTGTGCCAAATACTCGAGTATTTGGCACAAGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-2264s1c1
Sequence:CCGGCCTTTCCTACACCCTCAGTATCTCGAGATACTGAGGGTGTAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-1094s1c1
Sequence:CCGGCCCTACTGGAACTTATTGTTACTCGAGTAACAATAAGTTCCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-583s1c1
Sequence:CCGGGCACTACACATTGCAGTAATACTCGAGTATTACTGCAATGTGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-1926s1c1
Sequence:CCGGGCTCATGCTTAACCTCCTCATCTCGAGATGAGGAGGTTAAGCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022413
TRPV6 MISSION shRNA shRNA Plasmid DNA
transient receptor potential cation channel, subfamily V, member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-914s1c1
Sequence:CCGGCCCTGGAACTTGTGCCAAATACTCGAGTATTTGGCACAAGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-2264s1c1
Sequence:CCGGCCTTTCCTACACCCTCAGTATCTCGAGATACTGAGGGTGTAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-1094s1c1
Sequence:CCGGCCCTACTGGAACTTATTGTTACTCGAGTAACAATAAGTTCCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-583s1c1
Sequence:CCGGGCACTACACATTGCAGTAATACTCGAGTATTACTGCAATGTGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-1926s1c1
Sequence:CCGGGCTCATGCTTAACCTCCTCATCTCGAGATGAGGAGGTTAAGCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022413
TRPV6 MISSION shRNA Lentiviral Transduction Particles
transient receptor potential cation channel, subfamily V, member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-914s1c1
Sequence:CCGGCCCTGGAACTTGTGCCAAATACTCGAGTATTTGGCACAAGTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-2264s1c1
Sequence:CCGGCCTTTCCTACACCCTCAGTATCTCGAGATACTGAGGGTGTAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-1094s1c1
Sequence:CCGGCCCTACTGGAACTTATTGTTACTCGAGTAACAATAAGTTCCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-583s1c1
Sequence:CCGGGCACTACACATTGCAGTAATACTCGAGTATTACTGCAATGTGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022413.2-1926s1c1
Sequence:CCGGGCTCATGCTTAACCTCCTCATCTCGAGATGAGGAGGTTAAGCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks