EMAIL THIS PAGE TO A FRIEND

TRRAP

transformation/transcription domain-associated protein

Synonyms: PAF350/400 PAF400 STAF40 TR-AP Tra1
UniProtKB ID: Q9Y4A5, A4D265, O75218, Q9Y631, Q9Y6H4
Gene ID:
Human(8295) Summary: This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Mouse(100683) transformation/transcription domain-associated protein
Rat(288471) transformation/transcription domain-associated protein
Zebrafish(557263) transformation/transcription domain-associated protein
Horse(100059214) transformation/transcription domain-associated protein
domestic cat(101083988) transformation/transcription domain-associated protein
dog(479747) transformation/transcription domain-associated protein
chicken(416440) transformation/transcription domain-associated protein
cow(507169) transformation/transcription domain-associated protein
sheep(101103618) transformation/transcription domain-associated protein
domestic guinea pig(100723821) transformation/transcription domain-associated protein
naked mole-rat(101722141) transformation/transcription domain-associated protein
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0436 AQUA Peptide NYSIAQ[K] human, mouse pricing
AQ0438 AQUA Peptide SFHHVTHDLV[R] human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003496 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133901 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133901 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133901 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003496 Rosetta Predictions human pricing
NM_001105907 Rosetta Predictions rat pricing
NM_001081362 Rosetta Predictions mouse pricing
XM_891798 Rosetta Predictions mouse pricing
XM_899733 Rosetta Predictions mouse pricing
XM_899741 Rosetta Predictions mouse pricing
XM_899747 Rosetta Predictions mouse pricing
XM_899754 Rosetta Predictions mouse pricing
XM_899771 Rosetta Predictions mouse pricing
XM_990950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180951 predicted 11164
2 SASI_Hs02_00335775 predicted 11148
3 SASI_Hs02_00335776 predicted 7503
4 SASI_Hs01_00180953 predicted 4292
5 SASI_Hs01_00180954 predicted 627
6 SASI_Hs01_00180956 predicted 11403
7 SASI_Hs01_00180957 predicted 9263
8 SASI_Hs01_00180958 predicted 326
9 SASI_Hs02_00335777 predicted 9028
10 SASI_Hs01_00180960 predicted 7715
11 SASI_Hs01_00180952 predicted 6242
12 SASI_Hs01_00180955 predicted 3781
13 SASI_Hs01_00180959 predicted 4598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213712 predicted 11418
2 SASI_Rn02_00213713 predicted 11170
3 SASI_Rn02_00213714 predicted 11246
4 SASI_Rn02_00213715 predicted 11454
5 SASI_Rn02_00213716 predicted 11361
6 SASI_Rn02_00213717 predicted 11085
7 SASI_Rn02_00213718 predicted 11699
8 SASI_Rn02_00213719 predicted 11125
9 SASI_Rn02_00213720 predicted 11302
10 SASI_Rn02_00213721 predicted 11224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297671 predicted 11408
2 SASI_Mm02_00297672 predicted 987
3 SASI_Mm02_00297673 predicted 3529
4 SASI_Mm02_00297674 predicted 10225
5 SASI_Mm02_00297675 predicted 841
6 SASI_Mm02_00297676 predicted 9170
7 SASI_Mm02_00297677 predicted 3950
8 SASI_Mm02_00297678 predicted 6174
9 SASI_Mm02_00297679 predicted 8150
10 SASI_Mm02_00297680 predicted 3978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239909 predicted 8249
2 SASI_Mm01_00239910 predicted 8170
3 SASI_Mm01_00239911 predicted 5901
4 SASI_Mm01_00239912 predicted 4825
5 SASI_Mm01_00239913 predicted 6767
6 SASI_Mm01_00239914 predicted 6638
7 SASI_Mm01_00239915 predicted 8616
8 SASI_Mm01_00239916 predicted 6952
9 SASI_Mm01_00239917 predicted 5814
10 SASI_Mm01_00239918 predicted 8247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261513 predicted 223
2 SASI_Mm01_00261514 predicted 216
3 SASI_Mm01_00261515 predicted 326
4 SASI_Mm01_00261516 predicted 265
5 SASI_Mm01_00261517 predicted 231
6 SASI_Mm01_00261518 predicted 208
7 SASI_Mm01_00261519 predicted 210
8 SASI_Mm01_00261520 predicted 293
9 SASI_Mm01_00261521 predicted 301
10 SASI_Mm01_00261522 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273751 predicted 7794
2 SASI_Mm01_00273752 predicted 7708
3 SASI_Mm01_00273753 predicted 5440
4 SASI_Mm01_00273754 predicted 4367
5 SASI_Mm01_00273755 predicted 6302
6 SASI_Mm01_00273756 predicted 6181
7 SASI_Mm01_00273757 predicted 8160
8 SASI_Mm01_00273758 predicted 6482
9 SASI_Mm01_00273759 predicted 5350
10 SASI_Mm01_00273760 predicted 7792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226805 predicted 2724
2 SASI_Mm01_00226806 predicted 2739
3 SASI_Mm01_00226807 predicted 2756
4 SASI_Mm01_00226808 predicted 2810
5 SASI_Mm01_00226809 predicted 2674
6 SASI_Mm01_00226810 predicted 2657
7 SASI_Mm01_00226811 predicted 2791
8 SASI_Mm01_00226812 predicted 2719
9 SASI_Mm01_00226813 predicted 2780
10 SASI_Mm01_00226814 predicted 2750
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244675 predicted 4330
2 SASI_Mm01_00244676 predicted 4352
3 SASI_Mm01_00244677 predicted 4370
4 SASI_Mm01_00244678 predicted 4420
5 SASI_Mm01_00244679 predicted 4280
6 SASI_Mm01_00244680 predicted 4261
7 SASI_Mm01_00244681 predicted 4406
8 SASI_Mm01_00244682 predicted 4320
9 SASI_Mm01_00244683 predicted 4393
10 SASI_Mm01_00244684 predicted 4349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269505 predicted 2995
2 SASI_Mm01_00269506 predicted 3018
3 SASI_Mm01_00269507 predicted 3032
4 SASI_Mm01_00269508 predicted 3077
5 SASI_Mm01_00269509 predicted 2939
6 SASI_Mm01_00269510 predicted 2929
7 SASI_Mm01_00269511 predicted 3072
8 SASI_Mm01_00269512 predicted 2986
9 SASI_Mm01_00269513 predicted 3054
10 SASI_Mm01_00269514 predicted 3013
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268253 predicted 2706
2 SASI_Mm01_00268254 predicted 2721
3 SASI_Mm01_00268255 predicted 2741
4 SASI_Mm01_00268256 predicted 2785
5 SASI_Mm01_00268257 predicted 2651
6 SASI_Mm01_00268258 predicted 2630
7 SASI_Mm01_00268259 predicted 2771
8 SASI_Mm01_00268260 predicted 2692
9 SASI_Mm01_00268261 predicted 2759
10 SASI_Mm01_00268262 predicted 2722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081362
TRRAP MISSION shRNA Bacterial Glycerol Stock
transformation/transcription domain-associated protein
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000368838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081362.1-3454s21c1
Sequence:CCGGGTAGCCCTGGCCGTGATATTTCTCGAGAAATATCACGGCCAGGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081362.1-10560s21c1
Sequence:CCGGTATCAAGATCGCTCGCTTTATCTCGAGATAAAGCGAGCGATCTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081362.1-1904s21c1
Sequence:CCGGCGATGCAGGCCTTGGATATTTCTCGAGAAATATCCAAGGCCTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081362
TRRAP MISSION shRNA shRNA Plasmid DNA
transformation/transcription domain-associated protein
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000368838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081362.1-3454s21c1
Sequence:CCGGGTAGCCCTGGCCGTGATATTTCTCGAGAAATATCACGGCCAGGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081362.1-10560s21c1
Sequence:CCGGTATCAAGATCGCTCGCTTTATCTCGAGATAAAGCGAGCGATCTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081362.1-1904s21c1
Sequence:CCGGCGATGCAGGCCTTGGATATTTCTCGAGAAATATCCAAGGCCTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081362
TRRAP MISSION shRNA Lentiviral Transduction Particles
transformation/transcription domain-associated protein
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000368838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081362.1-3454s21c1
Sequence:CCGGGTAGCCCTGGCCGTGATATTTCTCGAGAAATATCACGGCCAGGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081362.1-10560s21c1
Sequence:CCGGTATCAAGATCGCTCGCTTTATCTCGAGATAAAGCGAGCGATCTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081362.1-1904s21c1
Sequence:CCGGCGATGCAGGCCTTGGATATTTCTCGAGAAATATCCAAGGCCTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003496
VALIDATED
TRRAP MISSION shRNA Bacterial Glycerol Stock
transformation/transcription domain-associated protein
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-882s21c1
Sequence:CCGGTTGGCAGAATTGCCCATTATTCTCGAGAATAATGGGCAATTCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003496.1-11812s21c1
Sequence:CCGGTTCACTGGGTTGCGGTTATTTCTCGAGAAATAACCGCAACCCAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.2-4690s21c1
Sequence:CCGGAGATTTGCTCAGCAATTATAACTCGAGTTATAATTGCTGAGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.2-2162s21c1
Sequence:CCGGCCAAACTACGGTCCCTTATATCTCGAGATATAAGGGACCGTAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-5816s21c1
Sequence:CCGGGGCGCACATTATCGCCAAATTCTCGAGAATTTGGCGATAATGTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-10579s21c1
Sequence:CCGGTGCCAAAGCCAACGCATTATTCTCGAGAATAATGCGTTGGCTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-4301s21c1
Sequence:CCGGTTTACGAATTGCGGCATTAAACTCGAGTTTAATGCCGCAATTCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003496.1-12120s1c1
Sequence:CCGGCAGACCTTTGTAACAAGTGTACTCGAGTACACTTGTTACAAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003496.1-4299s1c1
Sequence:CCGGCCTTTACGAATTGCGGCATTACTCGAGTAATGCCGCAATTCGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003496.1-6319s1c1
Sequence:CCGGCCCAGGAAGTGAAACGCTTTACTCGAGTAAAGCGTTTCACTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003496.1-11846s1c1
Sequence:CCGGCGTGTAAGAAAGGGAGAATATCTCGAGATATTCTCCCTTTCTTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003496.1-9695s1c1
Sequence:CCGGCGAGAGCAAATCGAGGAAATACTCGAGTATTTCCTCGATTTGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003496.1-720s1c1
Sequence:CCGGCGCTACTTTGAGAACCCTCAACTCGAGTTGAGGGTTCTCAAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003496.1-5406s1c1
Sequence:CCGGGCCCTGTTCTTTCGCTTTGTACTCGAGTACAAAGCGAAAGAACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003496
VALIDATED
TRRAP MISSION shRNA shRNA Plasmid DNA
transformation/transcription domain-associated protein
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-882s21c1
Sequence:CCGGTTGGCAGAATTGCCCATTATTCTCGAGAATAATGGGCAATTCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003496.1-11812s21c1
Sequence:CCGGTTCACTGGGTTGCGGTTATTTCTCGAGAAATAACCGCAACCCAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.2-4690s21c1
Sequence:CCGGAGATTTGCTCAGCAATTATAACTCGAGTTATAATTGCTGAGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.2-2162s21c1
Sequence:CCGGCCAAACTACGGTCCCTTATATCTCGAGATATAAGGGACCGTAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-5816s21c1
Sequence:CCGGGGCGCACATTATCGCCAAATTCTCGAGAATTTGGCGATAATGTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-10579s21c1
Sequence:CCGGTGCCAAAGCCAACGCATTATTCTCGAGAATAATGCGTTGGCTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-4301s21c1
Sequence:CCGGTTTACGAATTGCGGCATTAAACTCGAGTTTAATGCCGCAATTCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003496.1-12120s1c1
Sequence:CCGGCAGACCTTTGTAACAAGTGTACTCGAGTACACTTGTTACAAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003496.1-4299s1c1
Sequence:CCGGCCTTTACGAATTGCGGCATTACTCGAGTAATGCCGCAATTCGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003496.1-6319s1c1
Sequence:CCGGCCCAGGAAGTGAAACGCTTTACTCGAGTAAAGCGTTTCACTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003496.1-11846s1c1
Sequence:CCGGCGTGTAAGAAAGGGAGAATATCTCGAGATATTCTCCCTTTCTTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003496.1-9695s1c1
Sequence:CCGGCGAGAGCAAATCGAGGAAATACTCGAGTATTTCCTCGATTTGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003496.1-720s1c1
Sequence:CCGGCGCTACTTTGAGAACCCTCAACTCGAGTTGAGGGTTCTCAAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003496.1-5406s1c1
Sequence:CCGGGCCCTGTTCTTTCGCTTTGTACTCGAGTACAAAGCGAAAGAACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003496
VALIDATED
TRRAP MISSION shRNA Lentiviral Transduction Particles
transformation/transcription domain-associated protein
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-882s21c1
Sequence:CCGGTTGGCAGAATTGCCCATTATTCTCGAGAATAATGGGCAATTCTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003496.1-11812s21c1
Sequence:CCGGTTCACTGGGTTGCGGTTATTTCTCGAGAAATAACCGCAACCCAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.2-4690s21c1
Sequence:CCGGAGATTTGCTCAGCAATTATAACTCGAGTTATAATTGCTGAGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.2-2162s21c1
Sequence:CCGGCCAAACTACGGTCCCTTATATCTCGAGATATAAGGGACCGTAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-5816s21c1
Sequence:CCGGGGCGCACATTATCGCCAAATTCTCGAGAATTTGGCGATAATGTGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-10579s21c1
Sequence:CCGGTGCCAAAGCCAACGCATTATTCTCGAGAATAATGCGTTGGCTTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003496.1-4301s21c1
Sequence:CCGGTTTACGAATTGCGGCATTAAACTCGAGTTTAATGCCGCAATTCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003496.1-12120s1c1
Sequence:CCGGCAGACCTTTGTAACAAGTGTACTCGAGTACACTTGTTACAAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003496.1-4299s1c1
Sequence:CCGGCCTTTACGAATTGCGGCATTACTCGAGTAATGCCGCAATTCGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003496.1-6319s1c1
Sequence:CCGGCCCAGGAAGTGAAACGCTTTACTCGAGTAAAGCGTTTCACTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003496.1-11846s1c1
Sequence:CCGGCGTGTAAGAAAGGGAGAATATCTCGAGATATTCTCCCTTTCTTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003496.1-9695s1c1
Sequence:CCGGCGAGAGCAAATCGAGGAAATACTCGAGTATTTCCTCGATTTGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003496.1-720s1c1
Sequence:CCGGCGCTACTTTGAGAACCCTCAACTCGAGTTGAGGGTTCTCAAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003496.1-5406s1c1
Sequence:CCGGGCCCTGTTCTTTCGCTTTGTACTCGAGTACAAAGCGAAAGAACAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133901
VALIDATED
TRRAP MISSION shRNA Bacterial Glycerol Stock
transformation/transcription domain-associated protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133901.2-4727s1c1
Sequence:CCGGCGGGAGGCAGAGGCAGGCAATCTCGAGATTGCCTGCCTCTGCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-2261s1c1
Sequence:CCGGGTGTCAACTCAGTGTCCATTACTCGAGTAATGGACACTGAGTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-4150s1c1
Sequence:CCGGCCCAGCGCATTGAACTGCTTTCTCGAGAAAGCAGTTCAATGCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-4389s1c1
Sequence:CCGGCGCTGAACTTTACTCTCTGTTCTCGAGAACAGAGAGTAAAGTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-1074s1c1
Sequence:CCGGCATCAAGATCATAAGCATCATCTCGAGATGATGCTTATGATCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133901
VALIDATED
TRRAP MISSION shRNA shRNA Plasmid DNA
transformation/transcription domain-associated protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133901.2-4727s1c1
Sequence:CCGGCGGGAGGCAGAGGCAGGCAATCTCGAGATTGCCTGCCTCTGCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-2261s1c1
Sequence:CCGGGTGTCAACTCAGTGTCCATTACTCGAGTAATGGACACTGAGTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-4150s1c1
Sequence:CCGGCCCAGCGCATTGAACTGCTTTCTCGAGAAAGCAGTTCAATGCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-4389s1c1
Sequence:CCGGCGCTGAACTTTACTCTCTGTTCTCGAGAACAGAGAGTAAAGTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-1074s1c1
Sequence:CCGGCATCAAGATCATAAGCATCATCTCGAGATGATGCTTATGATCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133901
VALIDATED
TRRAP MISSION shRNA Lentiviral Transduction Particles
transformation/transcription domain-associated protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133901.2-4727s1c1
Sequence:CCGGCGGGAGGCAGAGGCAGGCAATCTCGAGATTGCCTGCCTCTGCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-2261s1c1
Sequence:CCGGGTGTCAACTCAGTGTCCATTACTCGAGTAATGGACACTGAGTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-4150s1c1
Sequence:CCGGCCCAGCGCATTGAACTGCTTTCTCGAGAAAGCAGTTCAATGCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-4389s1c1
Sequence:CCGGCGCTGAACTTTACTCTCTGTTCTCGAGAACAGAGAGTAAAGTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133901.2-1074s1c1
Sequence:CCGGCATCAAGATCATAAGCATCATCTCGAGATGATGCTTATGATCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks