EMAIL THIS PAGE TO A FRIEND

TRUB1

TruB pseudouridine (psi) synthase family member 1

Synonyms: PUS4
UniProtKB ID: Q8WWH5, B2R716, Q53ES2
Gene ID:
Human(142940) Summary: Pseudouridine is an abundant component of rRNAs and tRNAs and is enzymatically generated by isomerization of uridine by pseudouridine synthase (Zucchini et al., 2003 [PubMed 12736709]
Mouse(72133) TruB pseudouridine (psi) synthase homolog 1 (E. coli)
Rat(361775) TruB pseudouridine (psi) synthase homolog 1 (E. coli)
Zebrafish(556642) TruB pseudouridine (psi) synthase homolog 1 (E. coli)
domestic cat(101082697) TruB pseudouridine (psi) synthase homolog 1 (E. coli)
chicken(423914) TruB pseudouridine (psi) synthase homolog 1 (E. coli)
dog(486900) TruB pseudouridine (psi) synthase homolog 1 (E. coli)
naked mole-rat(101701564) TruB pseudouridine (psi) synthase homolog 1 (E. coli)
domestic guinea pig(100719064) TruB pseudouridine (psi) synthase homolog 1 (E. coli)
cow(530353) TruB pseudouridine (psi) synthase homolog 1 (E. coli)
sheep(101119599) TruB pseudouridine (psi) synthase homolog 1 (E. coli)
Gene Class: Dehydratase
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139169 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139169 Rosetta Predictions human pricing
NM_001012173 Rosetta Predictions rat pricing
XM_574696 Rosetta Predictions rat pricing
NM_028115 Rosetta Predictions mouse pricing
NM_029839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364197 predicted 437
2 SASI_Hs01_00057979 predicted 445
3 SASI_Hs01_00057980 predicted 962
4 SASI_Hs01_00057981 predicted 1569
5 SASI_Hs01_00057982 predicted 494
6 SASI_Hs01_00057983 predicted 241
7 SASI_Hs01_00057984 predicted 648
8 SASI_Hs01_00057985 predicted 498
9 SASI_Hs01_00057986 predicted 787
10 SASI_Hs01_00057987 predicted 684
11 SASI_Hs01_00057988 predicted 1457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044127 predicted 1011
2 SASI_Rn01_00044128 predicted 1113
3 SASI_Rn01_00044129 predicted 540
4 SASI_Rn01_00044130 predicted 472
5 SASI_Rn02_00200373 predicted 768
6 SASI_Rn01_00044131 predicted 1096
7 SASI_Rn01_00044132 predicted 1051
8 SASI_Rn01_00044134 predicted 489
9 SASI_Rn01_00044135 predicted 468
10 SASI_Rn01_00044136 predicted 855
11 SASI_Rn01_00044133 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125281 predicted 1018
2 SASI_Rn01_00125282 predicted 1123
3 SASI_Rn01_00125283 predicted 544
4 SASI_Rn01_00125284 predicted 480
5 SASI_Rn01_00125285 predicted 1108
6 SASI_Rn01_00125286 predicted 1062
7 SASI_Rn01_00125287 predicted 1131
8 SASI_Rn01_00125288 predicted 490
9 SASI_Rn01_00125289 predicted 478
10 SASI_Rn01_00125290 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333364 predicted 488
2 SASI_Mm02_00333365 predicted 492
3 SASI_Mm01_00148870 predicted 467
4 SASI_Mm02_00333366 predicted 480
5 SASI_Mm01_00148872 predicted 469
6 SASI_Mm02_00333367 predicted 471
7 SASI_Mm02_00333368 predicted 453
8 SASI_Mm02_00333369 predicted 449
9 SASI_Mm02_00333370 predicted 422
10 SASI_Mm02_00333371 predicted 455
11 SASI_Mm01_00148865 predicted 972
12 SASI_Mm01_00148866 predicted 546
13 SASI_Mm01_00148867 predicted 514
14 SASI_Mm01_00148868 predicted 359
15 SASI_Mm01_00148869 predicted 676
16 SASI_Mm01_00148871 predicted 951
17 SASI_Mm01_00148873 predicted 1082
18 SASI_Mm01_00148874 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336027 predicted 481
2 SASI_Mm02_00336028 predicted 482
3 SASI_Mm02_00336029 predicted 459
4 SASI_Mm02_00336030 predicted 480
5 SASI_Mm02_00336031 predicted 455
6 SASI_Mm02_00336032 predicted 466
7 SASI_Mm02_00336033 predicted 449
8 SASI_Mm02_00336034 predicted 448
9 SASI_Mm02_00336035 predicted 415
10 SASI_Mm02_00336036 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139169
VALIDATED
TRUB1 MISSION shRNA Bacterial Glycerol Stock
TruB pseudouridine (psi) synthase family member 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139169.3-1025s1c1
Sequence:CCGGCCTGAGTCTAATGAACAGGTTCTCGAGAACCTGTTCATTAGACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_139169.3-749s1c1
Sequence:CCGGGTATACAGTATCTCCCTTCAACTCGAGTTGAAGGGAGATACTGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139169.3-854s1c1
Sequence:CCGGGAACTATCTTCCTGTGCCAATCTCGAGATTGGCACAGGAAGATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139169.3-1073s1c1
Sequence:CCGGGAGCCAAAGAGAGAAGATGATCTCGAGATCATCTTCTCTCTTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_139169.3-890s1c1
Sequence:CCGGCGAACCAAACAGGGACCATTTCTCGAGAAATGGTCCCTGTTTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139169.3-319s1c1
Sequence:CCGGGAATCGGTTGAAGGAGAAGCTCTCGAGAGCTTCTCCTTCAACCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-1559s21c1
Sequence:CCGGTGTTTAAAGTGGCCATTATTGCTCGAGCAATAATGGCCACTTTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139169.4-1116s21c1
Sequence:CCGGGGCCTGGGAATATCATCATTTCTCGAGAAATGATGATATTCCCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-490s21c1
Sequence:CCGGGTCAGGGTCCAAGAGATATACCTCGAGGTATATCTCTTGGACCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-891s21c1
Sequence:CCGGGAACCAAACAGGGACCATTTACTCGAGTAAATGGTCCCTGTTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-610s21c1
Sequence:CCGGAGGCATTCTACAGAAATTTACCTCGAGGTAAATTTCTGTAGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-1080s21c1
Sequence:CCGGAGAGAGAAGATGATGTAATTACTCGAGTAATTACATCATCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139169
VALIDATED
TRUB1 MISSION shRNA shRNA Plasmid DNA
TruB pseudouridine (psi) synthase family member 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139169.3-1025s1c1
Sequence:CCGGCCTGAGTCTAATGAACAGGTTCTCGAGAACCTGTTCATTAGACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_139169.3-749s1c1
Sequence:CCGGGTATACAGTATCTCCCTTCAACTCGAGTTGAAGGGAGATACTGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139169.3-854s1c1
Sequence:CCGGGAACTATCTTCCTGTGCCAATCTCGAGATTGGCACAGGAAGATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139169.3-1073s1c1
Sequence:CCGGGAGCCAAAGAGAGAAGATGATCTCGAGATCATCTTCTCTCTTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_139169.3-890s1c1
Sequence:CCGGCGAACCAAACAGGGACCATTTCTCGAGAAATGGTCCCTGTTTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139169.3-319s1c1
Sequence:CCGGGAATCGGTTGAAGGAGAAGCTCTCGAGAGCTTCTCCTTCAACCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-1559s21c1
Sequence:CCGGTGTTTAAAGTGGCCATTATTGCTCGAGCAATAATGGCCACTTTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139169.4-1116s21c1
Sequence:CCGGGGCCTGGGAATATCATCATTTCTCGAGAAATGATGATATTCCCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-490s21c1
Sequence:CCGGGTCAGGGTCCAAGAGATATACCTCGAGGTATATCTCTTGGACCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-891s21c1
Sequence:CCGGGAACCAAACAGGGACCATTTACTCGAGTAAATGGTCCCTGTTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-610s21c1
Sequence:CCGGAGGCATTCTACAGAAATTTACCTCGAGGTAAATTTCTGTAGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-1080s21c1
Sequence:CCGGAGAGAGAAGATGATGTAATTACTCGAGTAATTACATCATCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139169
VALIDATED
TRUB1 MISSION shRNA Lentiviral Transduction Particles
TruB pseudouridine (psi) synthase family member 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139169.3-1025s1c1
Sequence:CCGGCCTGAGTCTAATGAACAGGTTCTCGAGAACCTGTTCATTAGACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_139169.3-749s1c1
Sequence:CCGGGTATACAGTATCTCCCTTCAACTCGAGTTGAAGGGAGATACTGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139169.3-854s1c1
Sequence:CCGGGAACTATCTTCCTGTGCCAATCTCGAGATTGGCACAGGAAGATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139169.3-1073s1c1
Sequence:CCGGGAGCCAAAGAGAGAAGATGATCTCGAGATCATCTTCTCTCTTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_139169.3-890s1c1
Sequence:CCGGCGAACCAAACAGGGACCATTTCTCGAGAAATGGTCCCTGTTTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139169.3-319s1c1
Sequence:CCGGGAATCGGTTGAAGGAGAAGCTCTCGAGAGCTTCTCCTTCAACCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-1559s21c1
Sequence:CCGGTGTTTAAAGTGGCCATTATTGCTCGAGCAATAATGGCCACTTTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139169.4-1116s21c1
Sequence:CCGGGGCCTGGGAATATCATCATTTCTCGAGAAATGATGATATTCCCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-490s21c1
Sequence:CCGGGTCAGGGTCCAAGAGATATACCTCGAGGTATATCTCTTGGACCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-891s21c1
Sequence:CCGGGAACCAAACAGGGACCATTTACTCGAGTAAATGGTCCCTGTTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-610s21c1
Sequence:CCGGAGGCATTCTACAGAAATTTACCTCGAGGTAAATTTCTGTAGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139169.4-1080s21c1
Sequence:CCGGAGAGAGAAGATGATGTAATTACTCGAGTAATTACATCATCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029839
VALIDATED
TRUB1 MISSION shRNA Bacterial Glycerol Stock
TruB pseudouridine (psi) synthase family member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-602s1c1
Sequence:CCGGGAGACTCTCAACGCTAATGAACTCGAGTTCATTAGCGTTGAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-305s1c1
Sequence:CCGGGCAGACATTGAAAGTCGGACACTCGAGTGTCCGACTTTCAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-572s1c1
Sequence:CCGGGCTCTATTCTGCGCTGAAGAACTCGAGTTCTTCAGCGCAGAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029839.1-1207s1c1
Sequence:CCGGGCACAAATAAAGACCACAAATCTCGAGATTTGTGGTCTTTATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-599s1c1
Sequence:CCGGGCAGAGACTCTCAACGCTAATCTCGAGATTAGCGTTGAGAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029839
VALIDATED
TRUB1 MISSION shRNA shRNA Plasmid DNA
TruB pseudouridine (psi) synthase family member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-602s1c1
Sequence:CCGGGAGACTCTCAACGCTAATGAACTCGAGTTCATTAGCGTTGAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-305s1c1
Sequence:CCGGGCAGACATTGAAAGTCGGACACTCGAGTGTCCGACTTTCAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-572s1c1
Sequence:CCGGGCTCTATTCTGCGCTGAAGAACTCGAGTTCTTCAGCGCAGAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029839.1-1207s1c1
Sequence:CCGGGCACAAATAAAGACCACAAATCTCGAGATTTGTGGTCTTTATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-599s1c1
Sequence:CCGGGCAGAGACTCTCAACGCTAATCTCGAGATTAGCGTTGAGAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029839
VALIDATED
TRUB1 MISSION shRNA Lentiviral Transduction Particles
TruB pseudouridine (psi) synthase family member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-602s1c1
Sequence:CCGGGAGACTCTCAACGCTAATGAACTCGAGTTCATTAGCGTTGAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-305s1c1
Sequence:CCGGGCAGACATTGAAAGTCGGACACTCGAGTGTCCGACTTTCAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-572s1c1
Sequence:CCGGGCTCTATTCTGCGCTGAAGAACTCGAGTTCTTCAGCGCAGAATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029839.1-1207s1c1
Sequence:CCGGGCACAAATAAAGACCACAAATCTCGAGATTTGTGGTCTTTATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029839.1-599s1c1
Sequence:CCGGGCAGAGACTCTCAACGCTAATCTCGAGATTAGCGTTGAGAGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks