EMAIL THIS PAGE TO A FRIEND

TRUB2

TruB pseudouridine (psi) synthase family member 2

Synonyms: CLONE24922 RP11-339B21.1
UniProtKB ID: O95900
Gene ID:
Human(26995) Summary: Pseudouridine is an abundant component of rRNAs and tRNAs and is enzymatically generated by isomerization of uridine by pseudouridine synthase (Zucchini et al., 2003 [PubMed 12736709]
Mouse(227682) TruB pseudouridine (psi) synthase homolog 2 (E. coli)
Rat(366012) TruB pseudouridine (psi) synthase homolog 2 (E. coli)
cow(511988) TruB pseudouridine (psi) synthase homolog 2 (E. coli)
sheep(101108213) TruB pseudouridine (psi) synthase homolog 2 (E. coli)
domestic guinea pig(100716546) TruB pseudouridine (psi) synthase homolog 2 (E. coli)
naked mole-rat(101697242) TruB pseudouridine (psi) synthase homolog 2 (E. coli)
Zebrafish(431747) TruB pseudouridine (psi) synthase homolog 2 (E. coli)
domestic cat(101093059) TruB pseudouridine (psi) synthase homolog 2 (E. coli)
chicken(417218) TruB pseudouridine (psi) synthase homolog 2 (E. coli)
dog(608574) TruB pseudouridine (psi) synthase homolog 2 (E. coli)
Gene Class: Dehydratase
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015679 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015679 Rosetta Predictions human pricing
NM_001014257 Rosetta Predictions rat pricing
XM_001052990 Rosetta Predictions rat pricing
NM_145520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142801 predicted 635
2 SASI_Hs01_00142802 predicted 238
3 SASI_Hs01_00142803 predicted 478
4 SASI_Hs01_00142804 predicted 489
5 SASI_Hs01_00142805 predicted 464
6 SASI_Hs01_00142806 predicted 593
7 SASI_Hs01_00142807 predicted 351
8 SASI_Hs01_00142808 predicted 681
9 SASI_Hs01_00142809 predicted 713
10 SASI_Hs01_00142810 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083401 predicted 271
2 SASI_Rn01_00083402 predicted 1058
3 SASI_Rn01_00083403 predicted 867
4 SASI_Rn01_00083404 predicted 276
5 SASI_Rn01_00083405 predicted 862
6 SASI_Rn01_00083406 predicted 659
7 SASI_Rn01_00083407 predicted 871
8 SASI_Rn01_00083408 predicted 1059
9 SASI_Rn01_00083409 predicted 621
10 SASI_Rn01_00083410 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270954 predicted 258
2 SASI_Rn02_00270955 predicted 760
3 SASI_Rn02_00270956 predicted 872
4 SASI_Rn02_00270957 predicted 618
5 SASI_Rn02_00270958 predicted 625
6 SASI_Rn02_00270959 predicted 875
7 SASI_Rn02_00270960 predicted 611
8 SASI_Rn02_00270961 predicted 629
9 SASI_Rn02_00270962 predicted 511
10 SASI_Rn02_00270963 predicted 141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145716 predicted 1020
2 SASI_Mm01_00145717 predicted 1247
3 SASI_Mm01_00145718 predicted 1978
4 SASI_Mm01_00145719 predicted 1532
5 SASI_Mm01_00145720 predicted 1468
6 SASI_Mm01_00145721 predicted 1339
7 SASI_Mm01_00145722 predicted 1782
8 SASI_Mm02_00340993 predicted 1299
9 SASI_Mm01_00145723 predicted 1448
10 SASI_Mm01_00145724 predicted 1320
11 SASI_Mm01_00145725 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145520
VALIDATED
TRUB2 MISSION shRNA Bacterial Glycerol Stock
TruB pseudouridine (psi) synthase family member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145520.4-469s21c1
Sequence:CCGGGCTACAGACAACTTCTGTGAACTCGAGTTCACAGAAGTTGTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145520.4-625s21c1
Sequence:CCGGGCCTATGAGATGGCTGTGCAACTCGAGTTGCACAGCCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145520.4-1961s21c1
Sequence:CCGGGCCCTGTGATACAATGCTGTACTCGAGTACAGCATTGTATCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145520.4-494s21c1
Sequence:CCGGGACGGCTGATAGAGAAGACAACTCGAGTTGTCTTCTCTATCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-2792s1c1
Sequence:CCGGGCCCTGTGATACAATGCTGTACTCGAGTACAGCATTGTATCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-1457s1c1
Sequence:CCGGGCCTATGAGATGGCTGTGCAACTCGAGTTGCACAGCCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-1301s1c1
Sequence:CCGGGCTACAGACAACTTCTGTGAACTCGAGTTCACAGAAGTTGTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-1326s1c1
Sequence:CCGGGACGGCTGATAGAGAAGACAACTCGAGTTGTCTTCTCTATCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145520.2-989s1c1
Sequence:CCGGCAACTGCTTAAAGGTCTCAATCTCGAGATTGAGACCTTTAAGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145520
VALIDATED
TRUB2 MISSION shRNA shRNA Plasmid DNA
TruB pseudouridine (psi) synthase family member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145520.4-469s21c1
Sequence:CCGGGCTACAGACAACTTCTGTGAACTCGAGTTCACAGAAGTTGTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145520.4-625s21c1
Sequence:CCGGGCCTATGAGATGGCTGTGCAACTCGAGTTGCACAGCCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145520.4-1961s21c1
Sequence:CCGGGCCCTGTGATACAATGCTGTACTCGAGTACAGCATTGTATCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145520.4-494s21c1
Sequence:CCGGGACGGCTGATAGAGAAGACAACTCGAGTTGTCTTCTCTATCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-2792s1c1
Sequence:CCGGGCCCTGTGATACAATGCTGTACTCGAGTACAGCATTGTATCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-1457s1c1
Sequence:CCGGGCCTATGAGATGGCTGTGCAACTCGAGTTGCACAGCCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-1301s1c1
Sequence:CCGGGCTACAGACAACTTCTGTGAACTCGAGTTCACAGAAGTTGTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-1326s1c1
Sequence:CCGGGACGGCTGATAGAGAAGACAACTCGAGTTGTCTTCTCTATCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145520.2-989s1c1
Sequence:CCGGCAACTGCTTAAAGGTCTCAATCTCGAGATTGAGACCTTTAAGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145520
VALIDATED
TRUB2 MISSION shRNA Lentiviral Transduction Particles
TruB pseudouridine (psi) synthase family member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145520.4-469s21c1
Sequence:CCGGGCTACAGACAACTTCTGTGAACTCGAGTTCACAGAAGTTGTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145520.4-625s21c1
Sequence:CCGGGCCTATGAGATGGCTGTGCAACTCGAGTTGCACAGCCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145520.4-1961s21c1
Sequence:CCGGGCCCTGTGATACAATGCTGTACTCGAGTACAGCATTGTATCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145520.4-494s21c1
Sequence:CCGGGACGGCTGATAGAGAAGACAACTCGAGTTGTCTTCTCTATCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-2792s1c1
Sequence:CCGGGCCCTGTGATACAATGCTGTACTCGAGTACAGCATTGTATCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-1457s1c1
Sequence:CCGGGCCTATGAGATGGCTGTGCAACTCGAGTTGCACAGCCATCTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-1301s1c1
Sequence:CCGGGCTACAGACAACTTCTGTGAACTCGAGTTCACAGAAGTTGTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145520.2-1326s1c1
Sequence:CCGGGACGGCTGATAGAGAAGACAACTCGAGTTGTCTTCTCTATCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145520.2-989s1c1
Sequence:CCGGCAACTGCTTAAAGGTCTCAATCTCGAGATTGAGACCTTTAAGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015679
VALIDATED
TRUB2 MISSION shRNA Bacterial Glycerol Stock
TruB pseudouridine (psi) synthase family member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-224s21c1
Sequence:CCGGGTACCCTCTTTCATCAACCATCTCGAGATGGTTGATGAAAGAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015679.1-1027s21c1
Sequence:CCGGGCAGTGGATGGATAAATAGAACTCGAGTTCTATTTATCCATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-450s21c1
Sequence:CCGGTGGTAGAGAAGACAACCTATGCTCGAGCATAGGTTGTCTTCTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-715s21c1
Sequence:CCGGGCGGAAGTTGGTTCATGAAATCTCGAGATTTCATGAACCAACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-690s21c1
Sequence:CCGGGCATGCATGAGACGCAGAAAGCTCGAGCTTTCTGCGTCTCATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015679.1-1027s1c1
Sequence:CCGGGCAGTGGATGGATAAATAGAACTCGAGTTCTATTTATCCATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-227s1c1
Sequence:CCGGCCCTCTTTCATCAACCATCCACTCGAGTGGATGGTTGATGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-224s1c1
Sequence:CCGGGTACCCTCTTTCATCAACCATCTCGAGATGGTTGATGAAAGAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-362s1c1
Sequence:CCGGGATATGTACAATGCTCATCTTCTCGAGAAGATGAGCATTGTACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-506s1c1
Sequence:CCGGGCCGTTATCCAAGGCTCCCATCTCGAGATGGGAGCCTTGGATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015679
VALIDATED
TRUB2 MISSION shRNA shRNA Plasmid DNA
TruB pseudouridine (psi) synthase family member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-224s21c1
Sequence:CCGGGTACCCTCTTTCATCAACCATCTCGAGATGGTTGATGAAAGAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015679.1-1027s21c1
Sequence:CCGGGCAGTGGATGGATAAATAGAACTCGAGTTCTATTTATCCATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-450s21c1
Sequence:CCGGTGGTAGAGAAGACAACCTATGCTCGAGCATAGGTTGTCTTCTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-715s21c1
Sequence:CCGGGCGGAAGTTGGTTCATGAAATCTCGAGATTTCATGAACCAACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-690s21c1
Sequence:CCGGGCATGCATGAGACGCAGAAAGCTCGAGCTTTCTGCGTCTCATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015679.1-1027s1c1
Sequence:CCGGGCAGTGGATGGATAAATAGAACTCGAGTTCTATTTATCCATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-227s1c1
Sequence:CCGGCCCTCTTTCATCAACCATCCACTCGAGTGGATGGTTGATGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-224s1c1
Sequence:CCGGGTACCCTCTTTCATCAACCATCTCGAGATGGTTGATGAAAGAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-362s1c1
Sequence:CCGGGATATGTACAATGCTCATCTTCTCGAGAAGATGAGCATTGTACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-506s1c1
Sequence:CCGGGCCGTTATCCAAGGCTCCCATCTCGAGATGGGAGCCTTGGATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015679
VALIDATED
TRUB2 MISSION shRNA Lentiviral Transduction Particles
TruB pseudouridine (psi) synthase family member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-224s21c1
Sequence:CCGGGTACCCTCTTTCATCAACCATCTCGAGATGGTTGATGAAAGAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015679.1-1027s21c1
Sequence:CCGGGCAGTGGATGGATAAATAGAACTCGAGTTCTATTTATCCATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-450s21c1
Sequence:CCGGTGGTAGAGAAGACAACCTATGCTCGAGCATAGGTTGTCTTCTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-715s21c1
Sequence:CCGGGCGGAAGTTGGTTCATGAAATCTCGAGATTTCATGAACCAACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015679.1-690s21c1
Sequence:CCGGGCATGCATGAGACGCAGAAAGCTCGAGCTTTCTGCGTCTCATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015679.1-1027s1c1
Sequence:CCGGGCAGTGGATGGATAAATAGAACTCGAGTTCTATTTATCCATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-227s1c1
Sequence:CCGGCCCTCTTTCATCAACCATCCACTCGAGTGGATGGTTGATGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-224s1c1
Sequence:CCGGGTACCCTCTTTCATCAACCATCTCGAGATGGTTGATGAAAGAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-362s1c1
Sequence:CCGGGATATGTACAATGCTCATCTTCTCGAGAAGATGAGCATTGTACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015679.1-506s1c1
Sequence:CCGGGCCGTTATCCAAGGCTCCCATCTCGAGATGGGAGCCTTGGATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks