EMAIL THIS PAGE TO A FRIEND

TSACC

TSSK6 activating co-chaperone

Synonyms: C1orf182 RP11-443G18.5 SIP SSTK-IP
UniProtKB ID: Q96A04, D3DVB9
Gene ID:
Mouse(76927) TSSK6 activating co-chaperone
Rat(361979) TSSK6 activating co-chaperone
cow(767912) chromosome 3 open reading frame, human C1orf182
sheep(101104873) TSSK6 activating co-chaperone
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144627 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU160291 MISSION® esiRNA esiRNA targeting mouse 1700021C14Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144627 Rosetta Predictions human pricing
NM_001108556 Rosetta Predictions rat pricing
NM_029801 Rosetta Predictions mouse pricing
XM_001001264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364453 predicted 361
2 SASI_Hs01_00187726 predicted 392
3 SASI_Hs01_00187727 predicted 368
4 SASI_Hs01_00187728 predicted 374
5 SASI_Hs01_00187729 predicted 447
6 SASI_Hs01_00187730 predicted 407
7 SASI_Hs01_00187731 predicted 407
8 SASI_Hs02_00364454 predicted 365
9 SASI_Hs01_00187734 predicted 506
10 SASI_Hs01_00187735 predicted 399
11 SASI_Hs01_00187732 predicted 410
12 SASI_Hs01_00187733 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239799 predicted 231
2 SASI_Rn02_00239800 predicted 191
3 SASI_Rn02_00239801 predicted 244
4 SASI_Rn02_00239802 predicted 196
5 SASI_Rn02_00239803 predicted 222
6 SASI_Rn02_00239804 predicted 206
7 SASI_Rn02_00239805 predicted 199
8 SASI_Rn02_00239806 predicted 198
9 SASI_Rn02_00239807 predicted 240
10 SASI_Rn02_00239808 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335953 predicted 215
2 SASI_Mm02_00335954 predicted 199
3 SASI_Mm02_00335955 predicted 204
4 SASI_Mm02_00335956 predicted 260
5 SASI_Mm02_00335957 predicted 198
6 SASI_Mm02_00335958 predicted 220
7 SASI_Mm02_00335959 predicted 230
8 SASI_Mm02_00335960 predicted 215
9 SASI_Mm02_00335961 predicted 253
10 SASI_Mm02_00335962 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254125 predicted 222
2 SASI_Mm01_00254126 predicted 211
3 SASI_Mm01_00254127 predicted 210
4 SASI_Mm01_00254128 predicted 268
5 SASI_Mm01_00254129 predicted 212
6 SASI_Mm01_00254130 predicted 216
7 SASI_Mm01_00254131 predicted 231
8 SASI_Mm01_00254132 predicted 213
9 SASI_Mm01_00254133 predicted 254
10 SASI_Mm01_00254134 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144627
TSACC MISSION shRNA Bacterial Glycerol Stock
TSSK6 activating co-chaperone
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-552s1c1
Sequence:CCGGCTAGGACTCCTGGAATGTATGCTCGAGCATACATTCCAGGAGTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-403s1c1
Sequence:CCGGCAGCCAAAGAGGAAGCTAATGCTCGAGCATTAGCTTCCTCTTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-405s1c1
Sequence:CCGGGCCAAAGAGGAAGCTAATGCTCTCGAGAGCATTAGCTTCCTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-402s1c1
Sequence:CCGGCCAGCCAAAGAGGAAGCTAATCTCGAGATTAGCTTCCTCTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-604s1c1
Sequence:CCGGCCCAACAACAGATGGCTGTTTCTCGAGAAACAGCCATCTGTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-572s1c1
Sequence:CCGGGTATGCAAACCTCCAGCTTCACTCGAGTGAAGCTGGAGGTTTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-528s1c1
Sequence:CCGGGTTGATCACAAGCCCAAGGAACTCGAGTTCCTTGGGCTTGTGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-406s1c1
Sequence:CCGGCCAAAGAGGAAGCTAATGCTGCTCGAGCAGCATTAGCTTCCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-564s1c1
Sequence:CCGGGAATGTATGTATGCAAACCTCCTCGAGGAGGTTTGCATACATACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-500s1c1
Sequence:CCGGGAACATCCAGACAACAAAGCTCTCGAGAGCTTTGTTGTCTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-407s1c1
Sequence:CCGGCAAAGAGGAAGCTAATGCTGTCTCGAGACAGCATTAGCTTCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144627
TSACC MISSION shRNA shRNA Plasmid DNA
TSSK6 activating co-chaperone
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-552s1c1
Sequence:CCGGCTAGGACTCCTGGAATGTATGCTCGAGCATACATTCCAGGAGTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-403s1c1
Sequence:CCGGCAGCCAAAGAGGAAGCTAATGCTCGAGCATTAGCTTCCTCTTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-405s1c1
Sequence:CCGGGCCAAAGAGGAAGCTAATGCTCTCGAGAGCATTAGCTTCCTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-402s1c1
Sequence:CCGGCCAGCCAAAGAGGAAGCTAATCTCGAGATTAGCTTCCTCTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-604s1c1
Sequence:CCGGCCCAACAACAGATGGCTGTTTCTCGAGAAACAGCCATCTGTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-572s1c1
Sequence:CCGGGTATGCAAACCTCCAGCTTCACTCGAGTGAAGCTGGAGGTTTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-528s1c1
Sequence:CCGGGTTGATCACAAGCCCAAGGAACTCGAGTTCCTTGGGCTTGTGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-406s1c1
Sequence:CCGGCCAAAGAGGAAGCTAATGCTGCTCGAGCAGCATTAGCTTCCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-564s1c1
Sequence:CCGGGAATGTATGTATGCAAACCTCCTCGAGGAGGTTTGCATACATACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-500s1c1
Sequence:CCGGGAACATCCAGACAACAAAGCTCTCGAGAGCTTTGTTGTCTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-407s1c1
Sequence:CCGGCAAAGAGGAAGCTAATGCTGTCTCGAGACAGCATTAGCTTCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144627
TSACC MISSION shRNA Lentiviral Transduction Particles
TSSK6 activating co-chaperone
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-552s1c1
Sequence:CCGGCTAGGACTCCTGGAATGTATGCTCGAGCATACATTCCAGGAGTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-403s1c1
Sequence:CCGGCAGCCAAAGAGGAAGCTAATGCTCGAGCATTAGCTTCCTCTTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-405s1c1
Sequence:CCGGGCCAAAGAGGAAGCTAATGCTCTCGAGAGCATTAGCTTCCTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-402s1c1
Sequence:CCGGCCAGCCAAAGAGGAAGCTAATCTCGAGATTAGCTTCCTCTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-604s1c1
Sequence:CCGGCCCAACAACAGATGGCTGTTTCTCGAGAAACAGCCATCTGTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-572s1c1
Sequence:CCGGGTATGCAAACCTCCAGCTTCACTCGAGTGAAGCTGGAGGTTTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-528s1c1
Sequence:CCGGGTTGATCACAAGCCCAAGGAACTCGAGTTCCTTGGGCTTGTGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-406s1c1
Sequence:CCGGCCAAAGAGGAAGCTAATGCTGCTCGAGCAGCATTAGCTTCCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-564s1c1
Sequence:CCGGGAATGTATGTATGCAAACCTCCTCGAGGAGGTTTGCATACATACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-500s1c1
Sequence:CCGGGAACATCCAGACAACAAAGCTCTCGAGAGCTTTGTTGTCTGGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144627.1-407s1c1
Sequence:CCGGCAAAGAGGAAGCTAATGCTGTCTCGAGACAGCATTAGCTTCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029801
TSACC MISSION shRNA Bacterial Glycerol Stock
TSSK6 activating co-chaperone
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-226s21c1
Sequence:CCGGTTCTTGACCATCCAGACAAAGCTCGAGCTTTGTCTGGATGGTCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-249s21c1
Sequence:CCGGGTCTTCAGGAGCTGGTCAGAACTCGAGTTCTGACCAGCTCCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-294s21c1
Sequence:CCGGCGAGTGCATGTATGCCAACCTCTCGAGAGGTTGGCATACATGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-192s21c1
Sequence:CCGGCATTGATCTTCCAGCAAATTTCTCGAGAAATTTGCTGGAAGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-144s21c1
Sequence:CCGGGGAAGATAGCGTTGCGTGTTTCTCGAGAAACACGCAACGCTATCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029801
TSACC MISSION shRNA shRNA Plasmid DNA
TSSK6 activating co-chaperone
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-226s21c1
Sequence:CCGGTTCTTGACCATCCAGACAAAGCTCGAGCTTTGTCTGGATGGTCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-249s21c1
Sequence:CCGGGTCTTCAGGAGCTGGTCAGAACTCGAGTTCTGACCAGCTCCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-294s21c1
Sequence:CCGGCGAGTGCATGTATGCCAACCTCTCGAGAGGTTGGCATACATGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-192s21c1
Sequence:CCGGCATTGATCTTCCAGCAAATTTCTCGAGAAATTTGCTGGAAGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-144s21c1
Sequence:CCGGGGAAGATAGCGTTGCGTGTTTCTCGAGAAACACGCAACGCTATCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029801
TSACC MISSION shRNA Lentiviral Transduction Particles
TSSK6 activating co-chaperone
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-226s21c1
Sequence:CCGGTTCTTGACCATCCAGACAAAGCTCGAGCTTTGTCTGGATGGTCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-249s21c1
Sequence:CCGGGTCTTCAGGAGCTGGTCAGAACTCGAGTTCTGACCAGCTCCTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-294s21c1
Sequence:CCGGCGAGTGCATGTATGCCAACCTCTCGAGAGGTTGGCATACATGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-192s21c1
Sequence:CCGGCATTGATCTTCCAGCAAATTTCTCGAGAAATTTGCTGGAAGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029801.2-144s21c1
Sequence:CCGGGGAAGATAGCGTTGCGTGTTTCTCGAGAAACACGCAACGCTATCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks