EMAIL THIS PAGE TO A FRIEND

TSC1

tuberous sclerosis 1

Synonyms: LAM TSC
UniProtKB ID: Q92574, B7Z897, Q5VVN5
Gene ID:
Human(7248) Summary: This gene encodes a growth inhibitory protein thought to play a role in the stabilization of tuberin. Mutations in this gene have been associated with tuberous sclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Mouse(64930) tuberous sclerosis 1
Rat(60445) tuberous sclerosis 1
fruit fly(42862) CG6147 gene product from transcript CG6147-RA
Horse(100066615) tuberous sclerosis 1
domestic cat(101101514) tuberous sclerosis 1
dog(480688) tuberous sclerosis 1
chicken(417166) tuberous sclerosis 1
domestic guinea pig(100732297) tuberous sclerosis 1
naked mole-rat(101708424) tuberous sclerosis 1
Domestic Rabbit(100338695) tuberous sclerosis 1
cow(533440) tuberous sclerosis 1
sheep(101119127) tuberous sclerosis 1
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000368 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000368 Rosetta Predictions human pricing
NM_001008567 Rosetta Predictions human pricing
NM_021854 Rosetta Predictions rat pricing
NM_022887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302419 predicted 976
2 SASI_Hs01_00209100 predicted 666
3 SASI_Hs01_00209101 predicted 914
4 SASI_Hs01_00209102 predicted 840
5 SASI_Hs02_00302420 predicted 786
6 SASI_Hs01_00209103 predicted 979
7 SASI_Hs01_00209104 predicted 1033
8 SASI_Hs01_00209105 predicted 432
9 SASI_Hs01_00209106 predicted 837
10 SASI_Hs01_00209107 predicted 773
11 SASI_Hs01_00209099 predicted 687
12 SASI_Hs01_00209108 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305509 predicted 974
2 SASI_Hs01_00037124 predicted 673
3 SASI_Hs01_00037125 predicted 912
4 SASI_Hs01_00037126 predicted 846
5 SASI_Hs01_00037127 predicted 786
6 SASI_Hs01_00037128 predicted 979
7 SASI_Hs01_00037129 predicted 1035
8 SASI_Hs01_00037130 predicted 427
9 SASI_Hs01_00037131 predicted 837
10 SASI_Hs01_00037132 predicted 774
11 SASI_Hs01_00037133 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067214 predicted 491
2 SASI_Rn01_00067215 predicted 2275
3 SASI_Rn01_00067216 predicted 1325
4 SASI_Rn01_00067217 predicted 1431
5 SASI_Rn01_00067218 predicted 1093
6 SASI_Rn01_00067219 predicted 738
7 SASI_Rn01_00067220 predicted 2195
8 SASI_Rn01_00067221 predicted 2789
9 SASI_Rn01_00067223 predicted 682
10 SASI_Rn02_00262881 predicted 801
11 SASI_Rn01_00067222 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087217 predicted 1019
2 SASI_Mm01_00087218 predicted 2410
3 SASI_Mm01_00087220 predicted 1105
4 SASI_Mm01_00087221 predicted 2977
5 SASI_Mm02_00326681 predicted 802
6 SASI_Mm01_00087222 predicted 954
7 SASI_Mm01_00087223 predicted 1516
8 SASI_Mm01_00087224 predicted 1314
9 SASI_Mm01_00087225 predicted 418
10 SASI_Mm01_00087226 predicted 899
11 SASI_Mm01_00087219 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000368
VALIDATED
TSC1 MISSION shRNA Bacterial Glycerol Stock
tuberous sclerosis 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.4-477s21c1
Sequence:CCGGCAAAGCCGCCACTCGTTTATCCTCGAGGATAAACGAGTGGCGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.4-445s21c1
Sequence:CCGGCACCTCTTGGACAGGATTAACCTCGAGGTTAATCCTGTCCAAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-790s21c1
Sequence:CCGGGCACTCTTTCATCGCCTTTATCTCGAGATAAAGGCGATGAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000368.4-4050s21c1
Sequence:CCGGTGCAATATGAGGCCAAATTTACTCGAGTAAATTTGGCCTCATATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-476s21c1
Sequence:CCGGGCAAAGCCGCCACTCGTTTATCTCGAGATAAACGAGTGGCGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-1663s21c1
Sequence:CCGGAAAGAAGAAGCTGCAATATCTCTCGAGAGATATTGCAGCTTCTTCTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-451s21c1
Sequence:CCGGTTGGACAGGATTAACGAATATCTCGAGATATTCGTTAATCCTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000368.3-4049s21c1
Sequence:CCGGGTGCAATATGAGGCCAAATTTCTCGAGAAATTTGGCCTCATATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000368.x-2854s1c1
Sequence:CCGGAAAAGGATAACCCAGGTGTTTCTCGAGAAACACCTGGGTTATCCTTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000368.x-1449s1c1
Sequence:CCGGAAAGAAGAAGCTGCAATATCTCTCGAGAGATATTGCAGCTTCTTCTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000368.2-518s1c1
Sequence:CCGGGCAGCCATCTTGGAAGCATAACTCGAGTTATGCTTCCAAGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000368
VALIDATED
TSC1 MISSION shRNA shRNA Plasmid DNA
tuberous sclerosis 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.4-477s21c1
Sequence:CCGGCAAAGCCGCCACTCGTTTATCCTCGAGGATAAACGAGTGGCGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.4-445s21c1
Sequence:CCGGCACCTCTTGGACAGGATTAACCTCGAGGTTAATCCTGTCCAAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-790s21c1
Sequence:CCGGGCACTCTTTCATCGCCTTTATCTCGAGATAAAGGCGATGAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000368.4-4050s21c1
Sequence:CCGGTGCAATATGAGGCCAAATTTACTCGAGTAAATTTGGCCTCATATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-476s21c1
Sequence:CCGGGCAAAGCCGCCACTCGTTTATCTCGAGATAAACGAGTGGCGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-1663s21c1
Sequence:CCGGAAAGAAGAAGCTGCAATATCTCTCGAGAGATATTGCAGCTTCTTCTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-451s21c1
Sequence:CCGGTTGGACAGGATTAACGAATATCTCGAGATATTCGTTAATCCTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000368.3-4049s21c1
Sequence:CCGGGTGCAATATGAGGCCAAATTTCTCGAGAAATTTGGCCTCATATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000368.x-2854s1c1
Sequence:CCGGAAAAGGATAACCCAGGTGTTTCTCGAGAAACACCTGGGTTATCCTTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000368.x-1449s1c1
Sequence:CCGGAAAGAAGAAGCTGCAATATCTCTCGAGAGATATTGCAGCTTCTTCTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000368.2-518s1c1
Sequence:CCGGGCAGCCATCTTGGAAGCATAACTCGAGTTATGCTTCCAAGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000368
VALIDATED
TSC1 MISSION shRNA Lentiviral Transduction Particles
tuberous sclerosis 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.4-477s21c1
Sequence:CCGGCAAAGCCGCCACTCGTTTATCCTCGAGGATAAACGAGTGGCGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.4-445s21c1
Sequence:CCGGCACCTCTTGGACAGGATTAACCTCGAGGTTAATCCTGTCCAAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-790s21c1
Sequence:CCGGGCACTCTTTCATCGCCTTTATCTCGAGATAAAGGCGATGAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000368.4-4050s21c1
Sequence:CCGGTGCAATATGAGGCCAAATTTACTCGAGTAAATTTGGCCTCATATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-476s21c1
Sequence:CCGGGCAAAGCCGCCACTCGTTTATCTCGAGATAAACGAGTGGCGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-1663s21c1
Sequence:CCGGAAAGAAGAAGCTGCAATATCTCTCGAGAGATATTGCAGCTTCTTCTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000368.3-451s21c1
Sequence:CCGGTTGGACAGGATTAACGAATATCTCGAGATATTCGTTAATCCTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000368.3-4049s21c1
Sequence:CCGGGTGCAATATGAGGCCAAATTTCTCGAGAAATTTGGCCTCATATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000368.x-2854s1c1
Sequence:CCGGAAAAGGATAACCCAGGTGTTTCTCGAGAAACACCTGGGTTATCCTTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000368.x-1449s1c1
Sequence:CCGGAAAGAAGAAGCTGCAATATCTCTCGAGAGATATTGCAGCTTCTTCTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000368.2-518s1c1
Sequence:CCGGGCAGCCATCTTGGAAGCATAACTCGAGTTATGCTTCCAAGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022887
VALIDATED
TSC1 MISSION shRNA Bacterial Glycerol Stock
tuberous sclerosis 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-3475s21c1
Sequence:CCGGCCGGGAGCTGTTCCGTAATAACTCGAGTTATTACGGAACAGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-1325s21c1
Sequence:CCGGTTGTCACATCCGTATAGTAAACTCGAGTTTACTATACGGATGTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-346s21c1
Sequence:CCGGCAACACGTTGGTTGATTATTACTCGAGTAATAATCAACCAACGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-3987s21c1
Sequence:CCGGGTGCAATATGAGGCCAAATTTCTCGAGAAATTTGGCCTCATATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-462s21c1
Sequence:CCGGGCAAAGCTGCTACCCGTTTATCTCGAGATAAACGGGTAGCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022887.1-3719s1c1
Sequence:CCGGTCAGTGTTCATTTGCGTCTTTCTCGAGAAAGACGCAAATGAACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022887.1-1027s1c1
Sequence:CCGGGCCTCGTATGAAGATGGCTATCTCGAGATAGCCATCTTCATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022887.1-1028s1c1
Sequence:CCGGCCTCGTATGAAGATGGCTATTCTCGAGAATAGCCATCTTCATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022887.1-2475s1c1
Sequence:CCGGGCAGAAAGAACAAGCCCGATACTCGAGTATCGGGCTTGTTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022887.1-766s1c1
Sequence:CCGGGCCAGTGTTTATGCCCTCTTTCTCGAGAAAGAGGGCATAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022887
VALIDATED
TSC1 MISSION shRNA shRNA Plasmid DNA
tuberous sclerosis 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-3475s21c1
Sequence:CCGGCCGGGAGCTGTTCCGTAATAACTCGAGTTATTACGGAACAGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-1325s21c1
Sequence:CCGGTTGTCACATCCGTATAGTAAACTCGAGTTTACTATACGGATGTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-346s21c1
Sequence:CCGGCAACACGTTGGTTGATTATTACTCGAGTAATAATCAACCAACGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-3987s21c1
Sequence:CCGGGTGCAATATGAGGCCAAATTTCTCGAGAAATTTGGCCTCATATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-462s21c1
Sequence:CCGGGCAAAGCTGCTACCCGTTTATCTCGAGATAAACGGGTAGCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022887.1-3719s1c1
Sequence:CCGGTCAGTGTTCATTTGCGTCTTTCTCGAGAAAGACGCAAATGAACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022887.1-1027s1c1
Sequence:CCGGGCCTCGTATGAAGATGGCTATCTCGAGATAGCCATCTTCATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022887.1-1028s1c1
Sequence:CCGGCCTCGTATGAAGATGGCTATTCTCGAGAATAGCCATCTTCATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022887.1-2475s1c1
Sequence:CCGGGCAGAAAGAACAAGCCCGATACTCGAGTATCGGGCTTGTTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022887.1-766s1c1
Sequence:CCGGGCCAGTGTTTATGCCCTCTTTCTCGAGAAAGAGGGCATAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022887
VALIDATED
TSC1 MISSION shRNA Lentiviral Transduction Particles
tuberous sclerosis 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-3475s21c1
Sequence:CCGGCCGGGAGCTGTTCCGTAATAACTCGAGTTATTACGGAACAGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-1325s21c1
Sequence:CCGGTTGTCACATCCGTATAGTAAACTCGAGTTTACTATACGGATGTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-346s21c1
Sequence:CCGGCAACACGTTGGTTGATTATTACTCGAGTAATAATCAACCAACGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-3987s21c1
Sequence:CCGGGTGCAATATGAGGCCAAATTTCTCGAGAAATTTGGCCTCATATTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022887.3-462s21c1
Sequence:CCGGGCAAAGCTGCTACCCGTTTATCTCGAGATAAACGGGTAGCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113946    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022887.1-3719s1c1
Sequence:CCGGTCAGTGTTCATTTGCGTCTTTCTCGAGAAAGACGCAAATGAACACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022887.1-1027s1c1
Sequence:CCGGGCCTCGTATGAAGATGGCTATCTCGAGATAGCCATCTTCATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022887.1-1028s1c1
Sequence:CCGGCCTCGTATGAAGATGGCTATTCTCGAGAATAGCCATCTTCATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022887.1-2475s1c1
Sequence:CCGGGCAGAAAGAACAAGCCCGATACTCGAGTATCGGGCTTGTTCTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022887.1-766s1c1
Sequence:CCGGGCCAGTGTTTATGCCCTCTTTCTCGAGAAAGAGGGCATAAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks