EMAIL THIS PAGE TO A FRIEND

TSC22D1

TSC22 domain family, member 1

Synonyms: Ptg-2 TGFB1I4 TSC22
Gene ID:
Human(8848) Summary: This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Mouse(21807) TSC22 domain family, member 1
Rat(498545) TSC22 domain family, member 1
domestic guinea pig(100714610) TSC22 domain family, member 1
naked mole-rat(101719339) TSC22 domain family, member 1
cow(510359) TSC22 domain family, member 1
Zebrafish(335842) TSC22 domain family, member 1
Horse(100059678) TSC22 domain family, member 1
domestic cat(101085595) TSC22 domain family, member 1
dog(476927) TSC22 domain family, member 1
chicken(396005) TSC22 domain family, member 1
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006022 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091751 MISSION® esiRNA esiRNA human TSC22D1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006022 Rosetta Predictions human pricing
NM_183422 Rosetta Predictions human pricing
NM_001109912 Rosetta Predictions rat pricing
NM_013043 Rosetta Predictions rat pricing
NM_009366 Rosetta Predictions mouse pricing
NM_207652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340745 predicted 764
2 SASI_Hs01_00056746 predicted 842
3 SASI_Hs01_00056744 predicted 1118
4 SASI_Hs02_00340746 predicted 928
5 SASI_Hs01_00056749 predicted 898
6 SASI_Hs02_00340747 predicted 1124
7 SASI_Hs01_00056745 predicted 1080
8 SASI_Hs01_00056752 predicted 828
9 SASI_Hs02_00340748 predicted 938
10 SASI_Hs02_00340749 predicted 743
11 SASI_Hs01_00056743 predicted 1133
12 SASI_Hs01_00056747 predicted 245
13 SASI_Hs01_00056748 predicted 412
14 SASI_Hs01_00056750 predicted 448
15 SASI_Hs01_00056751 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371327 predicted 3904
2 SASI_Hs01_00102711 predicted 4177
3 SASI_Hs02_00371328 predicted 3963
4 SASI_Hs01_00102712 predicted 4139
5 SASI_Hs02_00371329 predicted 3892
6 SASI_Hs01_00102710 predicted 4193
7 SASI_Hs02_00371330 predicted 4185
8 SASI_Hs01_00102714 predicted 1685
9 SASI_Hs01_00102715 predicted 3249
10 SASI_Hs02_00371331 predicted 2941
11 SASI_Hs01_00102713 predicted 1858
12 SASI_Hs01_00102716 predicted 944
13 SASI_Hs01_00102717 predicted 2803
14 SASI_Hs01_00102718 predicted 873
15 SASI_Hs01_00102719 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250882 predicted 3681
2 SASI_Rn02_00250883 predicted 3739
3 SASI_Rn02_00250884 predicted 3610
4 SASI_Rn02_00250885 predicted 3662
5 SASI_Rn02_00250886 predicted 3957
6 SASI_Rn02_00250887 predicted 3959
7 SASI_Rn02_00250888 predicted 3532
8 SASI_Rn02_00250889 predicted 3603
9 SASI_Rn02_00250890 predicted 3986
10 SASI_Rn02_00250891 predicted 3681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260758 predicted 810
2 SASI_Rn02_00260759 predicted 862
3 SASI_Rn02_00260760 predicted 216
4 SASI_Rn02_00260761 predicted 219
5 SASI_Rn02_00260762 predicted 1089
6 SASI_Rn02_00260763 predicted 734
7 SASI_Rn02_00260764 predicted 1111
8 SASI_Rn02_00260765 predicted 302
9 SASI_Rn02_00260766 predicted 806
10 SASI_Rn02_00260767 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056300 predicted 567
2 SASI_Mm01_00056301 predicted 773
3 SASI_Mm01_00056302 predicted 700
4 SASI_Mm01_00056303 predicted 768
5 SASI_Mm01_00056304 predicted 780
6 SASI_Mm01_00056305 predicted 705
7 SASI_Mm01_00056306 predicted 634
8 SASI_Mm01_00056307 predicted 778
9 SASI_Mm01_00056308 predicted 735
10 SASI_Mm01_00056309 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196955 predicted 3481
2 SASI_Mm01_00196956 predicted 3682
3 SASI_Mm01_00196957 predicted 3609
4 SASI_Mm01_00196958 predicted 3682
5 SASI_Mm01_00196959 predicted 3693
6 SASI_Mm01_00196960 predicted 3620
7 SASI_Mm01_00196961 predicted 3546
8 SASI_Mm01_00196962 predicted 3690
9 SASI_Mm01_00196963 predicted 3641
10 SASI_Mm01_00196964 predicted 3615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009366
VALIDATED
TSC22D1 MISSION shRNA Bacterial Glycerol Stock
TSC22 domain family, member 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009366.2-738s21c1
Sequence:CCGGCCAGTATTAAGCACTCATAAGCTCGAGCTTATGAGTGCTTAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-282s21c1
Sequence:CCGGGGTGCAAGTGTGGTAGCTATCCTCGAGGATAGCTACCACACTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009366.2-1244s21c1
Sequence:GTACCGGGTATGTAGTGTAACGAATTTGCTCGAGCAAATTCGTTACACTACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009366.2-384s21c1
Sequence:CCGGGAGCAGATCAAAGAACTAATACTCGAGTATTAGTTCTTTGATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-256s21c1
Sequence:CCGGCTTCCGTGAGACTTGACAATACTCGAGTATTGTCAAGTCTCACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-219s21c1
Sequence:CCGGATTTCTTTCTTGTCGTCTTTGCTCGAGCAAAGACGACAAGAAAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-194s21c1
Sequence:CCGGAGTTTACCAACTGAGACATTTCTCGAGAAATGTCTCAGTTGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-193s21c1
Sequence:CCGGGAGTTTACCAACTGAGACATTCTCGAGAATGTCTCAGTTGGTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009366.2-785s21c1
Sequence:CCGGTGAGTGAATTAAAGGTTAATCCTCGAGGATTAACCTTTAATTCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-251s1c1
Sequence:CCGGCCATTTCTTTCTTGTCGTCTTCTCGAGAAGACGACAAGAAAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-418s1c1
Sequence:CCGGGAGCAGATCAAAGAACTAATACTCGAGTATTAGTTCTTTGATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-409s1c1
Sequence:CCGGGTTCTGAAGGAGCAGATCAAACTCGAGTTTGATCTGCTCCTTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-227s1c1
Sequence:CCGGGAGTTTACCAACTGAGACATTCTCGAGAATGTCTCAGTTGGTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-290s1c1
Sequence:CCGGCTTCCGTGAGACTTGACAATACTCGAGTATTGTCAAGTCTCACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009366
VALIDATED
TSC22D1 MISSION shRNA shRNA Plasmid DNA
TSC22 domain family, member 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009366.2-738s21c1
Sequence:CCGGCCAGTATTAAGCACTCATAAGCTCGAGCTTATGAGTGCTTAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-282s21c1
Sequence:CCGGGGTGCAAGTGTGGTAGCTATCCTCGAGGATAGCTACCACACTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009366.2-1244s21c1
Sequence:GTACCGGGTATGTAGTGTAACGAATTTGCTCGAGCAAATTCGTTACACTACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009366.2-384s21c1
Sequence:CCGGGAGCAGATCAAAGAACTAATACTCGAGTATTAGTTCTTTGATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-256s21c1
Sequence:CCGGCTTCCGTGAGACTTGACAATACTCGAGTATTGTCAAGTCTCACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-219s21c1
Sequence:CCGGATTTCTTTCTTGTCGTCTTTGCTCGAGCAAAGACGACAAGAAAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-194s21c1
Sequence:CCGGAGTTTACCAACTGAGACATTTCTCGAGAAATGTCTCAGTTGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-193s21c1
Sequence:CCGGGAGTTTACCAACTGAGACATTCTCGAGAATGTCTCAGTTGGTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009366.2-785s21c1
Sequence:CCGGTGAGTGAATTAAAGGTTAATCCTCGAGGATTAACCTTTAATTCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-251s1c1
Sequence:CCGGCCATTTCTTTCTTGTCGTCTTCTCGAGAAGACGACAAGAAAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-418s1c1
Sequence:CCGGGAGCAGATCAAAGAACTAATACTCGAGTATTAGTTCTTTGATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-409s1c1
Sequence:CCGGGTTCTGAAGGAGCAGATCAAACTCGAGTTTGATCTGCTCCTTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-227s1c1
Sequence:CCGGGAGTTTACCAACTGAGACATTCTCGAGAATGTCTCAGTTGGTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-290s1c1
Sequence:CCGGCTTCCGTGAGACTTGACAATACTCGAGTATTGTCAAGTCTCACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009366
VALIDATED
TSC22D1 MISSION shRNA Lentiviral Transduction Particles
TSC22 domain family, member 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009366.2-738s21c1
Sequence:CCGGCCAGTATTAAGCACTCATAAGCTCGAGCTTATGAGTGCTTAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-282s21c1
Sequence:CCGGGGTGCAAGTGTGGTAGCTATCCTCGAGGATAGCTACCACACTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009366.2-1244s21c1
Sequence:GTACCGGGTATGTAGTGTAACGAATTTGCTCGAGCAAATTCGTTACACTACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009366.2-384s21c1
Sequence:CCGGGAGCAGATCAAAGAACTAATACTCGAGTATTAGTTCTTTGATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-256s21c1
Sequence:CCGGCTTCCGTGAGACTTGACAATACTCGAGTATTGTCAAGTCTCACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-219s21c1
Sequence:CCGGATTTCTTTCTTGTCGTCTTTGCTCGAGCAAAGACGACAAGAAAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-194s21c1
Sequence:CCGGAGTTTACCAACTGAGACATTTCTCGAGAAATGTCTCAGTTGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009366.2-193s21c1
Sequence:CCGGGAGTTTACCAACTGAGACATTCTCGAGAATGTCTCAGTTGGTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009366.2-785s21c1
Sequence:CCGGTGAGTGAATTAAAGGTTAATCCTCGAGGATTAACCTTTAATTCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-251s1c1
Sequence:CCGGCCATTTCTTTCTTGTCGTCTTCTCGAGAAGACGACAAGAAAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-418s1c1
Sequence:CCGGGAGCAGATCAAAGAACTAATACTCGAGTATTAGTTCTTTGATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-409s1c1
Sequence:CCGGGTTCTGAAGGAGCAGATCAAACTCGAGTTTGATCTGCTCCTTCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-227s1c1
Sequence:CCGGGAGTTTACCAACTGAGACATTCTCGAGAATGTCTCAGTTGGTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009366.1-290s1c1
Sequence:CCGGCTTCCGTGAGACTTGACAATACTCGAGTATTGTCAAGTCTCACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006022
VALIDATED
TSC22D1 MISSION shRNA Bacterial Glycerol Stock
TSC22 domain family, member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-348s21c1
Sequence:CCGGGGTGCAAGTGTGGTAGCTATTCTCGAGAATAGCTACCACACTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-1187s21c1
Sequence:CCGGGCCTCTTTCTTCTCAAACAATCTCGAGATTGTTTGAGAAGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-317s21c1
Sequence:CCGGCGCTTCTGTGAGACTTGATAACTCGAGTTATCAAGTCTCACAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006022.2-257s21c1
Sequence:CCGGAGTTTACCAACTGAGACATTTCTCGAGAAATGTCTCAGTTGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-450s21c1
Sequence:CCGGGAGCAAATCAAAGAACTAATACTCGAGTATTAGTTCTTTGATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006022.2-1187s1c1
Sequence:CCGGGCCTCTTTCTTCTCAAACAATCTCGAGATTGTTTGAGAAGAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006022.2-317s1c1
Sequence:CCGGCGCTTCTGTGAGACTTGATAACTCGAGTTATCAAGTCTCACAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006022.2-491s1c1
Sequence:CCGGGCAGGAGAACAATCTGCTGAACTCGAGTTCAGCAGATTGTTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006022.2-383s1c1
Sequence:CCGGGCAAGCTATGGATCTAGTGAACTCGAGTTCACTAGATCCATAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006022.2-441s1c1
Sequence:CCGGGTCCTCAAAGAGCAAATCAAACTCGAGTTTGATTTGCTCTTTGAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006022
VALIDATED
TSC22D1 MISSION shRNA shRNA Plasmid DNA
TSC22 domain family, member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-348s21c1
Sequence:CCGGGGTGCAAGTGTGGTAGCTATTCTCGAGAATAGCTACCACACTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-1187s21c1
Sequence:CCGGGCCTCTTTCTTCTCAAACAATCTCGAGATTGTTTGAGAAGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-317s21c1
Sequence:CCGGCGCTTCTGTGAGACTTGATAACTCGAGTTATCAAGTCTCACAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006022.2-257s21c1
Sequence:CCGGAGTTTACCAACTGAGACATTTCTCGAGAAATGTCTCAGTTGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-450s21c1
Sequence:CCGGGAGCAAATCAAAGAACTAATACTCGAGTATTAGTTCTTTGATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006022.2-1187s1c1
Sequence:CCGGGCCTCTTTCTTCTCAAACAATCTCGAGATTGTTTGAGAAGAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006022.2-317s1c1
Sequence:CCGGCGCTTCTGTGAGACTTGATAACTCGAGTTATCAAGTCTCACAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006022.2-491s1c1
Sequence:CCGGGCAGGAGAACAATCTGCTGAACTCGAGTTCAGCAGATTGTTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006022.2-383s1c1
Sequence:CCGGGCAAGCTATGGATCTAGTGAACTCGAGTTCACTAGATCCATAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006022.2-441s1c1
Sequence:CCGGGTCCTCAAAGAGCAAATCAAACTCGAGTTTGATTTGCTCTTTGAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006022
VALIDATED
TSC22D1 MISSION shRNA Lentiviral Transduction Particles
TSC22 domain family, member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-348s21c1
Sequence:CCGGGGTGCAAGTGTGGTAGCTATTCTCGAGAATAGCTACCACACTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-1187s21c1
Sequence:CCGGGCCTCTTTCTTCTCAAACAATCTCGAGATTGTTTGAGAAGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-317s21c1
Sequence:CCGGCGCTTCTGTGAGACTTGATAACTCGAGTTATCAAGTCTCACAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006022.2-257s21c1
Sequence:CCGGAGTTTACCAACTGAGACATTTCTCGAGAAATGTCTCAGTTGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006022.2-450s21c1
Sequence:CCGGGAGCAAATCAAAGAACTAATACTCGAGTATTAGTTCTTTGATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006022.2-1187s1c1
Sequence:CCGGGCCTCTTTCTTCTCAAACAATCTCGAGATTGTTTGAGAAGAAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006022.2-317s1c1
Sequence:CCGGCGCTTCTGTGAGACTTGATAACTCGAGTTATCAAGTCTCACAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006022.2-491s1c1
Sequence:CCGGGCAGGAGAACAATCTGCTGAACTCGAGTTCAGCAGATTGTTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006022.2-383s1c1
Sequence:CCGGGCAAGCTATGGATCTAGTGAACTCGAGTTCACTAGATCCATAGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006022.2-441s1c1
Sequence:CCGGGTCCTCAAAGAGCAAATCAAACTCGAGTTTGATTTGCTCTTTGAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks