EMAIL THIS PAGE TO A FRIEND

TSC22D2

TSC22 domain family, member 2

Synonyms: TILZ4a TILZ4b TILZ4c
UniProtKB ID: O75157, D3DNI5, Q6PI50, Q9H2Z6, Q9H2Z7, Q9H2Z8
Gene ID:
Mouse(72033) TSC22 domain family, member 2
Rat(499624) TSC22 domain family, member 2
Zebrafish(378875) TSC22 domain family 2
domestic cat(101097834) TSC22 domain family, member 2
dog(477111) TSC22 domain family, member 2
cow(541277) TSC22 domain family, member 2
sheep(101120128) TSC22 domain family, member 2
naked mole-rat(101697639) TSC22 domain family, member 2
domestic guinea pig(100718147) TSC22 domain family, member 2
193 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39137 Anti-TSC22D2 (AB1) antibody produced in rabbit affinity isolated antibody canine, zebrafish, guinea pig, rat, mouse, bovine, human, rabbit
western blot pricing
AV39138 Anti-TSC22D2 (AB2) antibody produced in rabbit affinity isolated antibody human, rat, bovine, horse, guinea pig, canine, mouse, rabbit
western blot pricing
HPA004926 Anti-TSC22D2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV33697 Anti-TSC22D2 antibody produced in rabbit IgG fraction of antiserum canine, human, rat, bovine, guinea pig, mouse, rabbit, horse
western blot pricing
SAB2102586 Anti-TSC22D2 antibody produced in rabbit affinity isolated antibody zebrafish, rat, guinea pig, rabbit, canine, bovine, human, mouse
western blot pricing
WH0009819M1 Monoclonal Anti-TSC22D2 antibody produced in mouse clone 6G10, ascites fluid, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014779 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081229 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081229 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081229 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014779 Rosetta Predictions human pricing
XM_001057984 Rosetta Predictions rat pricing
XM_574948 Rosetta Predictions rat pricing
NM_001081229 Rosetta Predictions mouse pricing
XM_485240 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189028 predicted 2446
2 SASI_Hs02_00346274 predicted 1915
3 SASI_Hs01_00189029 predicted 2415
4 SASI_Hs02_00346275 predicted 1428
5 SASI_Hs01_00189030 predicted 1448
6 SASI_Hs01_00189031 predicted 2548
7 SASI_Hs01_00189032 predicted 2271
8 SASI_Hs01_00189033 predicted 2066
9 SASI_Hs01_00189034 predicted 2715
10 SASI_Hs01_00189036 predicted 2558
11 SASI_Hs01_00189035 predicted 2005
12 SASI_Hs01_00189037 predicted 2016
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288156 predicted 1687
2 SASI_Rn02_00288157 predicted 1065
3 SASI_Rn02_00288158 predicted 1623
4 SASI_Rn02_00288159 predicted 1890
5 SASI_Rn02_00288160 predicted 389
6 SASI_Rn02_00288161 predicted 1729
7 SASI_Rn02_00288162 predicted 1530
8 SASI_Rn02_00288163 predicted 1846
9 SASI_Rn02_00288164 predicted 556
10 SASI_Rn02_00288165 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402805 predicted 1841
2 SASI_Rn02_00402806 predicted 1680
3 SASI_Rn02_00402807 predicted 1623
4 SASI_Rn02_00402808 predicted 1894
5 SASI_Rn02_00402809 predicted 394
6 SASI_Rn02_00402810 predicted 2367
7 SASI_Rn02_00402811 predicted 1729
8 SASI_Rn02_00402812 predicted 1842
9 SASI_Rn02_00402813 predicted 1668
10 SASI_Rn02_00402814 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296444 predicted 2055
2 SASI_Mm02_00296445 predicted 1071
3 SASI_Mm02_00296446 predicted 1731
4 SASI_Mm02_00296447 predicted 2308
5 SASI_Mm02_00296448 predicted 1721
6 SASI_Mm02_00296449 predicted 2089
7 SASI_Mm02_00296450 predicted 1888
8 SASI_Mm02_00296451 predicted 1622
9 SASI_Mm02_00296452 predicted 2370
10 SASI_Mm02_00296453 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252009 predicted 2065
2 SASI_Mm01_00252010 predicted 1074
3 SASI_Mm01_00252011 predicted 1537
4 SASI_Mm01_00252012 predicted 1736
5 SASI_Mm01_00252013 predicted 2316
6 SASI_Mm01_00252014 predicted 2338
7 SASI_Mm01_00252015 predicted 1725
8 SASI_Mm01_00252016 predicted 2091
9 SASI_Mm01_00252017 predicted 1901
10 SASI_Mm01_00252018 predicted 1635
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014779
VALIDATED
TSC22D2 MISSION shRNA Bacterial Glycerol Stock
TSC22 domain family, member 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014779.2-3285s1c1
Sequence:CCGGCCTGGCATATTTCTAACACTACTCGAGTAGTGTTAGAAATATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014779.2-2322s1c1
Sequence:CCGGGCTTTCTACCAAGCGTTCCATCTCGAGATGGAACGCTTGGTAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_014779.2-1918s1c1
Sequence:CCGGCCACTTCTGTTACTATGCCAACTCGAGTTGGCATAGTAACAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014779.2-884s1c1
Sequence:CCGGCCGATGGACGTGTATGGAATACTCGAGTATTCCATACACGTCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_014779.2-2163s1c1
Sequence:CCGGCCACTTTCTCTCATTGCTGAACTCGAGTTCAGCAATGAGAGAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-2265s21c1
Sequence:CCGGTCTGTATTCAGCATAGCTATTCTCGAGAATAGCTATGCTGAATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-549s21c1
Sequence:CCGGTCTTCCGAAGAGACGCTTAACCTCGAGGTTAAGCGTCTCTTCGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014779.2-3079s21c1
Sequence:CCGGCTTTCTGATTCAGTAACATTTCTCGAGAAATGTTACTGAATCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014779.2-3027s21c1
Sequence:CCGGCTGAGCCTTCCTATCACATTACTCGAGTAATGTGATAGGAAGGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-1992s21c1
Sequence:CCGGAGCAGGAGCAGCAGCATAATCCTCGAGGATTATGCTGCTGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-2336s21c1
Sequence:CCGGGTTCCATTTGAACACGTTAAACTCGAGTTTAACGTGTTCAAATGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-2556s21c1
Sequence:CCGGCTTTCAAGCAATGATCAATTACTCGAGTAATTGATCATTGCTTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014779
VALIDATED
TSC22D2 MISSION shRNA shRNA Plasmid DNA
TSC22 domain family, member 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014779.2-3285s1c1
Sequence:CCGGCCTGGCATATTTCTAACACTACTCGAGTAGTGTTAGAAATATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014779.2-2322s1c1
Sequence:CCGGGCTTTCTACCAAGCGTTCCATCTCGAGATGGAACGCTTGGTAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_014779.2-1918s1c1
Sequence:CCGGCCACTTCTGTTACTATGCCAACTCGAGTTGGCATAGTAACAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014779.2-884s1c1
Sequence:CCGGCCGATGGACGTGTATGGAATACTCGAGTATTCCATACACGTCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_014779.2-2163s1c1
Sequence:CCGGCCACTTTCTCTCATTGCTGAACTCGAGTTCAGCAATGAGAGAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-2265s21c1
Sequence:CCGGTCTGTATTCAGCATAGCTATTCTCGAGAATAGCTATGCTGAATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-549s21c1
Sequence:CCGGTCTTCCGAAGAGACGCTTAACCTCGAGGTTAAGCGTCTCTTCGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014779.2-3079s21c1
Sequence:CCGGCTTTCTGATTCAGTAACATTTCTCGAGAAATGTTACTGAATCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014779.2-3027s21c1
Sequence:CCGGCTGAGCCTTCCTATCACATTACTCGAGTAATGTGATAGGAAGGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-1992s21c1
Sequence:CCGGAGCAGGAGCAGCAGCATAATCCTCGAGGATTATGCTGCTGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-2336s21c1
Sequence:CCGGGTTCCATTTGAACACGTTAAACTCGAGTTTAACGTGTTCAAATGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-2556s21c1
Sequence:CCGGCTTTCAAGCAATGATCAATTACTCGAGTAATTGATCATTGCTTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014779
VALIDATED
TSC22D2 MISSION shRNA Lentiviral Transduction Particles
TSC22 domain family, member 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014779.2-3285s1c1
Sequence:CCGGCCTGGCATATTTCTAACACTACTCGAGTAGTGTTAGAAATATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014779.2-2322s1c1
Sequence:CCGGGCTTTCTACCAAGCGTTCCATCTCGAGATGGAACGCTTGGTAGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_014779.2-1918s1c1
Sequence:CCGGCCACTTCTGTTACTATGCCAACTCGAGTTGGCATAGTAACAGAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014779.2-884s1c1
Sequence:CCGGCCGATGGACGTGTATGGAATACTCGAGTATTCCATACACGTCCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_014779.2-2163s1c1
Sequence:CCGGCCACTTTCTCTCATTGCTGAACTCGAGTTCAGCAATGAGAGAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-2265s21c1
Sequence:CCGGTCTGTATTCAGCATAGCTATTCTCGAGAATAGCTATGCTGAATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-549s21c1
Sequence:CCGGTCTTCCGAAGAGACGCTTAACCTCGAGGTTAAGCGTCTCTTCGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014779.2-3079s21c1
Sequence:CCGGCTTTCTGATTCAGTAACATTTCTCGAGAAATGTTACTGAATCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014779.2-3027s21c1
Sequence:CCGGCTGAGCCTTCCTATCACATTACTCGAGTAATGTGATAGGAAGGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-1992s21c1
Sequence:CCGGAGCAGGAGCAGCAGCATAATCCTCGAGGATTATGCTGCTGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-2336s21c1
Sequence:CCGGGTTCCATTTGAACACGTTAAACTCGAGTTTAACGTGTTCAAATGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014779.2-2556s21c1
Sequence:CCGGCTTTCAAGCAATGATCAATTACTCGAGTAATTGATCATTGCTTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081229
VALIDATED
TSC22D2 MISSION shRNA Bacterial Glycerol Stock
TSC22 domain family, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081229.1-2234s21c1
Sequence:CCGGCTCAACAACAAGCAATGATAGCTCGAGCTATCATTGCTTGTTGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081229.1-4027s21c1
Sequence:CCGGGGTAGCCCACTAGCTAATTAACTCGAGTTAATTAGCTAGTGGGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081229.1-2122s21c1
Sequence:CCGGTTAGTGGAAAGAAACTCTTTACTCGAGTAAAGAGTTTCTTTCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081229.1-1882s21c1
Sequence:CCGGTCTGTATTCAGCATAGCTATTCTCGAGAATAGCTATGCTGAATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081229.1-2097s21c1
Sequence:CCGGAGTTCTAAAGGAGCAAATAAACTCGAGTTTATTTGCTCCTTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081229
VALIDATED
TSC22D2 MISSION shRNA shRNA Plasmid DNA
TSC22 domain family, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081229.1-2234s21c1
Sequence:CCGGCTCAACAACAAGCAATGATAGCTCGAGCTATCATTGCTTGTTGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081229.1-4027s21c1
Sequence:CCGGGGTAGCCCACTAGCTAATTAACTCGAGTTAATTAGCTAGTGGGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081229.1-2122s21c1
Sequence:CCGGTTAGTGGAAAGAAACTCTTTACTCGAGTAAAGAGTTTCTTTCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081229.1-1882s21c1
Sequence:CCGGTCTGTATTCAGCATAGCTATTCTCGAGAATAGCTATGCTGAATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081229.1-2097s21c1
Sequence:CCGGAGTTCTAAAGGAGCAAATAAACTCGAGTTTATTTGCTCCTTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081229
VALIDATED
TSC22D2 MISSION shRNA Lentiviral Transduction Particles
TSC22 domain family, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081229.1-2234s21c1
Sequence:CCGGCTCAACAACAAGCAATGATAGCTCGAGCTATCATTGCTTGTTGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081229.1-4027s21c1
Sequence:CCGGGGTAGCCCACTAGCTAATTAACTCGAGTTAATTAGCTAGTGGGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081229.1-2122s21c1
Sequence:CCGGTTAGTGGAAAGAAACTCTTTACTCGAGTAAAGAGTTTCTTTCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081229.1-1882s21c1
Sequence:CCGGTCTGTATTCAGCATAGCTATTCTCGAGAATAGCTATGCTGAATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081229.1-2097s21c1
Sequence:CCGGAGTTCTAAAGGAGCAAATAAACTCGAGTTTATTTGCTCCTTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks