EMAIL THIS PAGE TO A FRIEND

TSC22D3

TSC22 domain family, member 3

Synonyms: DIP DSIPI GILZ TSC-22R hDIP
Gene ID:
Human(1831) Summary: The protein encoded by this gene shares significant sequence identity with the murine TSC-22 and Drosophila shs, both of which are leucine zipper proteins, that function as transcriptional regulators. The expression of this gene is stimulated by glucocorticoids and interleukin 10, and it appears to play a key role in the anti-inflammatory and immunosuppressive effects of this steroid and chemokine. Transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(14605) TSC22 domain family, member 3
Rat(83514) TSC22 domain family, member 3
domestic guinea pig(100725107) TSC22 domain family, member 3
naked mole-rat(101723071) TSC22 domain family, member 3
cow(100125309) TSC22 domain family, member 3
sheep(101114590) TSC22 domain family, member 3
Zebrafish(393541) TSC22 domain family, member 3
chicken(768091) TSC22 domain family, member 3
dog(610366) TSC22 domain family, member 3
domestic cat(101086705) TSC22 domain family, member 3
dog(492057) TSC22 domain family, member 3
214 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004089 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU036501 MISSION® esiRNA esiRNA targeting mouse Tsc22d3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015881 Rosetta Predictions human pricing
NM_004089 Rosetta Predictions human pricing
NM_198057 Rosetta Predictions human pricing
NM_031345 Rosetta Predictions rat pricing
NM_001077364 Rosetta Predictions mouse pricing
NM_010286 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306668 predicted 763
2 SASI_Hs01_00160124 predicted 491
3 SASI_Hs01_00160125 predicted 754
4 SASI_Hs01_00160126 predicted 931
5 SASI_Hs02_00306669 predicted 770
6 SASI_Hs01_00160127 predicted 828
7 SASI_Hs01_00160128 predicted 540
8 SASI_Hs01_00160129 predicted 526
9 SASI_Hs01_00160130 predicted 554
10 SASI_Hs01_00160131 predicted 620
11 SASI_Hs01_00160122 predicted 674
12 SASI_Hs01_00160123 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336891 predicted 976
2 SASI_Hs01_00066920 predicted 692
3 SASI_Hs01_00066921 predicted 960
4 SASI_Hs01_00066922 predicted 1135
5 SASI_Hs02_00336892 predicted 982
6 SASI_Hs01_00066923 predicted 1029
7 SASI_Hs01_00066924 predicted 741
8 SASI_Hs01_00066925 predicted 729
9 SASI_Hs01_00066926 predicted 760
10 SASI_Hs01_00066927 predicted 826
11 SASI_Hs01_00066918 predicted 889
12 SASI_Hs01_00066919 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371614 predicted 1289
2 SASI_Hs01_00222405 predicted 1012
3 SASI_Hs01_00222406 predicted 1268
4 SASI_Hs01_00222407 predicted 1452
5 SASI_Hs02_00371615 predicted 1299
6 SASI_Hs01_00222408 predicted 1352
7 SASI_Hs01_00222409 predicted 1059
8 SASI_Hs01_00222410 predicted 1045
9 SASI_Hs01_00222411 predicted 1068
10 SASI_Hs01_00222412 predicted 1139
11 SASI_Hs01_00222403 predicted 1202
12 SASI_Hs01_00222404 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090067 predicted 235
2 SASI_Rn01_00090068 predicted 644
3 SASI_Rn01_00090069 predicted 697
4 SASI_Rn01_00090070 predicted 632
5 SASI_Rn01_00090071 predicted 931
6 SASI_Rn01_00090073 predicted 370
7 SASI_Rn01_00090074 predicted 645
8 SASI_Rn01_00090075 predicted 1086
9 SASI_Rn01_00090076 predicted 428
10 SASI_Rn02_00264580 predicted 1100
11 SASI_Rn01_00090072 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292562 predicted 886
2 SASI_Mm02_00292563 predicted 1221
3 SASI_Mm02_00292564 predicted 1305
4 SASI_Mm02_00292565 predicted 843
5 SASI_Mm02_00292566 predicted 948
6 SASI_Mm02_00292567 predicted 894
7 SASI_Mm02_00292568 predicted 1131
8 SASI_Mm02_00292569 predicted 791
9 SASI_Mm02_00292570 predicted 928
10 SASI_Mm02_00292571 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318242 predicted 710
2 SASI_Mm02_00318243 predicted 1039
3 SASI_Mm01_00034629 predicted 1123
4 SASI_Mm01_00034630 predicted 673
5 SASI_Mm01_00034632 predicted 765
6 SASI_Mm01_00034633 predicted 721
7 SASI_Mm01_00034635 predicted 953
8 SASI_Mm02_00318244 predicted 606
9 SASI_Mm02_00318245 predicted 760
10 SASI_Mm02_00318246 predicted 945
11 SASI_Mm01_00034627 predicted 385
12 SASI_Mm01_00034628 predicted 1035
13 SASI_Mm01_00034631 predicted 659
14 SASI_Mm01_00034634 predicted 638
15 SASI_Mm01_00034636 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010286
TSC22D3 MISSION shRNA Bacterial Glycerol Stock
TSC22 domain family, member 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-272s21c1
Sequence:CCGGCAATTTCTCCATCTCCTTCTTCTCGAGAAGAAGGAGATGGAGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-439s21c1
Sequence:CCGGAGGTCCTAAAGGAGCAGATTCCTCGAGGAATCTGCTCCTTTAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-411s21c1
Sequence:CCGGCTGATGTACGCTGTGAGAGAGCTCGAGCTCTCTCACAGCGTACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-323s21c1
Sequence:CCGGCGTTAAACTGGATAACAGTGCCTCGAGGCACTGTTATCCAGTTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010286.3-713s21c1
Sequence:CCGGCATCTCATGTGGAGAACTTTACTCGAGTAAAGTTCTCCACATGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-312s21c1
Sequence:CCGGGATGTGGTTTCCGTTAAACTGCTCGAGCAGTTTAACGGAAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-455s21c1
Sequence:CCGGGATTCGTGAGCTGCTTGAGAACTCGAGTTCTCAAGCAGCTCACGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010286.2-1004s1c1
Sequence:CCGGCCTGACAATGACTGTTCCTATCTCGAGATAGGAACAGTCATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-473s1c1
Sequence:CCGGGCGCGAGAACACCCTCCTGAACTCGAGTTCAGGAGGGTGTTCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-347s1c1
Sequence:CCGGCCTAGACAACAAGATTGAGCACTCGAGTGCTCAATCTTGTTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-593s1c1
Sequence:CCGGCCCTGGTGGTTCTGCGGTGTACTCGAGTACACCGCAGAACCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-237s1c1
Sequence:CCGGGCGGTCTATCAGCTGCACAATCTCGAGATTGTGCAGCTGATAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010286
TSC22D3 MISSION shRNA shRNA Plasmid DNA
TSC22 domain family, member 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-272s21c1
Sequence:CCGGCAATTTCTCCATCTCCTTCTTCTCGAGAAGAAGGAGATGGAGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-439s21c1
Sequence:CCGGAGGTCCTAAAGGAGCAGATTCCTCGAGGAATCTGCTCCTTTAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-411s21c1
Sequence:CCGGCTGATGTACGCTGTGAGAGAGCTCGAGCTCTCTCACAGCGTACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-323s21c1
Sequence:CCGGCGTTAAACTGGATAACAGTGCCTCGAGGCACTGTTATCCAGTTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010286.3-713s21c1
Sequence:CCGGCATCTCATGTGGAGAACTTTACTCGAGTAAAGTTCTCCACATGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-312s21c1
Sequence:CCGGGATGTGGTTTCCGTTAAACTGCTCGAGCAGTTTAACGGAAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-455s21c1
Sequence:CCGGGATTCGTGAGCTGCTTGAGAACTCGAGTTCTCAAGCAGCTCACGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010286.2-1004s1c1
Sequence:CCGGCCTGACAATGACTGTTCCTATCTCGAGATAGGAACAGTCATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-473s1c1
Sequence:CCGGGCGCGAGAACACCCTCCTGAACTCGAGTTCAGGAGGGTGTTCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-347s1c1
Sequence:CCGGCCTAGACAACAAGATTGAGCACTCGAGTGCTCAATCTTGTTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-593s1c1
Sequence:CCGGCCCTGGTGGTTCTGCGGTGTACTCGAGTACACCGCAGAACCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-237s1c1
Sequence:CCGGGCGGTCTATCAGCTGCACAATCTCGAGATTGTGCAGCTGATAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010286
TSC22D3 MISSION shRNA Lentiviral Transduction Particles
TSC22 domain family, member 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-272s21c1
Sequence:CCGGCAATTTCTCCATCTCCTTCTTCTCGAGAAGAAGGAGATGGAGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-439s21c1
Sequence:CCGGAGGTCCTAAAGGAGCAGATTCCTCGAGGAATCTGCTCCTTTAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-411s21c1
Sequence:CCGGCTGATGTACGCTGTGAGAGAGCTCGAGCTCTCTCACAGCGTACATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-323s21c1
Sequence:CCGGCGTTAAACTGGATAACAGTGCCTCGAGGCACTGTTATCCAGTTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010286.3-713s21c1
Sequence:CCGGCATCTCATGTGGAGAACTTTACTCGAGTAAAGTTCTCCACATGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-312s21c1
Sequence:CCGGGATGTGGTTTCCGTTAAACTGCTCGAGCAGTTTAACGGAAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010286.3-455s21c1
Sequence:CCGGGATTCGTGAGCTGCTTGAGAACTCGAGTTCTCAAGCAGCTCACGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010286.2-1004s1c1
Sequence:CCGGCCTGACAATGACTGTTCCTATCTCGAGATAGGAACAGTCATTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-473s1c1
Sequence:CCGGGCGCGAGAACACCCTCCTGAACTCGAGTTCAGGAGGGTGTTCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-347s1c1
Sequence:CCGGCCTAGACAACAAGATTGAGCACTCGAGTGCTCAATCTTGTTGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-593s1c1
Sequence:CCGGCCCTGGTGGTTCTGCGGTGTACTCGAGTACACCGCAGAACCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010286.2-237s1c1
Sequence:CCGGGCGGTCTATCAGCTGCACAATCTCGAGATTGTGCAGCTGATAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004089
VALIDATED
TSC22D3 MISSION shRNA Bacterial Glycerol Stock
TSC22 domain family, member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004089.3-396s21c1
Sequence:CCGGCCATAGACAACAAGATCGAACCTCGAGGTTCGATCTTGTTGTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004089.3-288s21c1
Sequence:CCGGCGGTCTACCAGCTGCACAATTCTCGAGAATTGTGCAGCTGGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004089.3-432s21c1
Sequence:CCGGTGAAGAATCATCTGATGTATGCTCGAGCATACATCAGATGATTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004089.3-351s21c1
Sequence:CCGGTTTCCGTTAAGCTGGACAACACTCGAGTGTTGTCCAGCTTAACGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004089.3-571s21c1
Sequence:CCGGGAAGTTCCAGTCCTGTCTGAGCTCGAGCTCAGACAGGACTGGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-700s1c1
Sequence:CCGGCCTAGTTCTTTCCAGTTTGTTCTCGAGAACAAACTGGAAAGAACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-301s1c1
Sequence:CCGGGCACAATTTCTCCATCTCCTTCTCGAGAAGGAGATGGAGAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004089.2-523s1c1
Sequence:CCGGGCGTGAGAACACCCTGTTGAACTCGAGTTCAACAGGGTGTTCTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-431s1c1
Sequence:CCGGGTGAAGAATCATCTGATGTATCTCGAGATACATCAGATGATTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-395s1c1
Sequence:CCGGGCCATAGACAACAAGATCGAACTCGAGTTCGATCTTGTTGTCTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004089
VALIDATED
TSC22D3 MISSION shRNA shRNA Plasmid DNA
TSC22 domain family, member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004089.3-396s21c1
Sequence:CCGGCCATAGACAACAAGATCGAACCTCGAGGTTCGATCTTGTTGTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004089.3-288s21c1
Sequence:CCGGCGGTCTACCAGCTGCACAATTCTCGAGAATTGTGCAGCTGGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004089.3-432s21c1
Sequence:CCGGTGAAGAATCATCTGATGTATGCTCGAGCATACATCAGATGATTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004089.3-351s21c1
Sequence:CCGGTTTCCGTTAAGCTGGACAACACTCGAGTGTTGTCCAGCTTAACGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004089.3-571s21c1
Sequence:CCGGGAAGTTCCAGTCCTGTCTGAGCTCGAGCTCAGACAGGACTGGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-700s1c1
Sequence:CCGGCCTAGTTCTTTCCAGTTTGTTCTCGAGAACAAACTGGAAAGAACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-301s1c1
Sequence:CCGGGCACAATTTCTCCATCTCCTTCTCGAGAAGGAGATGGAGAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004089.2-523s1c1
Sequence:CCGGGCGTGAGAACACCCTGTTGAACTCGAGTTCAACAGGGTGTTCTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-431s1c1
Sequence:CCGGGTGAAGAATCATCTGATGTATCTCGAGATACATCAGATGATTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-395s1c1
Sequence:CCGGGCCATAGACAACAAGATCGAACTCGAGTTCGATCTTGTTGTCTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004089
VALIDATED
TSC22D3 MISSION shRNA Lentiviral Transduction Particles
TSC22 domain family, member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004089.3-396s21c1
Sequence:CCGGCCATAGACAACAAGATCGAACCTCGAGGTTCGATCTTGTTGTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004089.3-288s21c1
Sequence:CCGGCGGTCTACCAGCTGCACAATTCTCGAGAATTGTGCAGCTGGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004089.3-432s21c1
Sequence:CCGGTGAAGAATCATCTGATGTATGCTCGAGCATACATCAGATGATTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004089.3-351s21c1
Sequence:CCGGTTTCCGTTAAGCTGGACAACACTCGAGTGTTGTCCAGCTTAACGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004089.3-571s21c1
Sequence:CCGGGAAGTTCCAGTCCTGTCTGAGCTCGAGCTCAGACAGGACTGGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-700s1c1
Sequence:CCGGCCTAGTTCTTTCCAGTTTGTTCTCGAGAACAAACTGGAAAGAACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-301s1c1
Sequence:CCGGGCACAATTTCTCCATCTCCTTCTCGAGAAGGAGATGGAGAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004089.2-523s1c1
Sequence:CCGGGCGTGAGAACACCCTGTTGAACTCGAGTTCAACAGGGTGTTCTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-431s1c1
Sequence:CCGGGTGAAGAATCATCTGATGTATCTCGAGATACATCAGATGATTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004089.2-395s1c1
Sequence:CCGGGCCATAGACAACAAGATCGAACTCGAGTTCGATCTTGTTGTCTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks