EMAIL THIS PAGE TO A FRIEND

TSC22D4

TSC22 domain family, member 4

Synonyms: THG-1 THG1 TILZ2
UniProtKB ID: Q9Y3Q8, A4D2C3, D6W5V9
Gene ID:
Human(81628) Summary: TSC22D4 is a member of the TSC22 domain family of leucine zipper transcriptional regulators (see TSC22D3; MIM 300506) (Kester et al., 1999 [PubMed 10488076]
Mouse(78829) TSC22 domain family, member 4
Rat(684980) TSC22 domain family, member 4
dog(479734) TSC22 domain family, member 4
domestic cat(101090823) TSC22 domain family, member 4
cow(524543) TSC22 domain family, member 4
sheep(101104955) TSC22 domain family, member 4
naked mole-rat(101719548) TSC22 domain family, member 4
domestic guinea pig(100726011) TSC22 domain family, member 4
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV30107 Anti-TSC22D4 (AB1) antibody produced in rabbit IgG fraction of antiserum guinea pig, rat, canine, human
western blot pricing
AV37339 Anti-TSC22D4 (AB2) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder mouse, rat, canine, human, bovine
immunohistochemistry, western blot pricing
SAB1412180 ANTI-TSC22D4 antibody produced in mouse clone 1A4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412228 ANTI-TSC22D4 antibody produced in mouse clone 1C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2107940 Anti-TSC22D4 antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, rabbit, human, pig, rat, canine, horse, mouse
immunohistochemistry, western blot pricing
HPA006757 Anti-TSC22D4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2105343 Anti-TSC22D4 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rabbit
western blot pricing
WH0081628M7 Monoclonal Anti-TSC22D4 antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, western blot pricing
SAB1405291 Monoclonal Anti-TSC22D4 antibody produced in mouse clone 3C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030935 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030935 Rosetta Predictions human pricing
NM_001044284 Rosetta Predictions rat pricing
NM_023910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062885 predicted 1482
2 SASI_Hs01_00062886 predicted 1720
3 SASI_Hs01_00062887 predicted 1658
4 SASI_Hs01_00062888 predicted 1451
5 SASI_Hs01_00062889 predicted 1917
6 SASI_Hs01_00062890 predicted 1478
7 SASI_Hs01_00062891 predicted 1364
8 SASI_Hs01_00062892 predicted 1545
9 SASI_Hs01_00062893 predicted 1687
10 SASI_Hs01_00062894 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205514 predicted 955
2 SASI_Rn02_00205515 predicted 1294
3 SASI_Rn02_00205516 predicted 602
4 SASI_Rn02_00205517 predicted 375
5 SASI_Rn02_00205518 predicted 398
6 SASI_Rn02_00205519 predicted 388
7 SASI_Rn02_00205520 predicted 625
8 SASI_Rn02_00205521 predicted 1150
9 SASI_Rn02_00205522 predicted 932
10 SASI_Rn02_00205523 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049422 predicted 1059
2 SASI_Mm01_00049423 predicted 1931
3 SASI_Mm01_00049424 predicted 1974
4 SASI_Mm01_00049425 predicted 2019
5 SASI_Mm01_00049426 predicted 1378
6 SASI_Mm01_00049427 predicted 1932
7 SASI_Mm01_00049428 predicted 1657
8 SASI_Mm01_00049429 predicted 1065
9 SASI_Mm01_00049430 predicted 1604
10 SASI_Mm01_00049431 predicted 1572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023910
VALIDATED
TSC22D4 MISSION shRNA Bacterial Glycerol Stock
TSC22 domain family, member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023910.4-2490s1c1
Sequence:CCGGGCCTGGAAAGATTTGGAGGTTCTCGAGAACCTCCAAATCTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023910.4-1822s1c1
Sequence:CCGGCCATAAGTCTCCAGACCCATTCTCGAGAATGGGTCTGGAGACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023910.4-1821s1c1
Sequence:CCGGTCCATAAGTCTCCAGACCCATCTCGAGATGGGTCTGGAGACTTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023910.4-1936s1c1
Sequence:CCGGCCTGGTTGGCATTGACAACAACTCGAGTTGTTGTCAATGCCAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023910.4-1290s1c1
Sequence:CCGGCGTGTGTGGATGTTTACAAGACTCGAGTCTTGTAAACATCCACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-1610s21c1
Sequence:GTACCGGTTGGCATTGACAACAAGATTGCTCGAGCAATCTTGTTGTCAATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-2053s21c1
Sequence:CCGGCAGCTCGGGAGAGGGTATTTACTCGAGTAAATACCCTCTCCCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-1492s21c1
Sequence:CCGGCATAAGTCTCCAGACCCATTTCTCGAGAAATGGGTCTGGAGACTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-1074s21c1
Sequence:CCGGGCTGGCTAGTTTGGGCATAAGCTCGAGCTTATGCCCAAACTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-922s21c1
Sequence:CCGGCAAGGTTTGGGAGAGCCTTATCTCGAGATAAGGCTCTCCCAAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023910
VALIDATED
TSC22D4 MISSION shRNA shRNA Plasmid DNA
TSC22 domain family, member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023910.4-2490s1c1
Sequence:CCGGGCCTGGAAAGATTTGGAGGTTCTCGAGAACCTCCAAATCTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023910.4-1822s1c1
Sequence:CCGGCCATAAGTCTCCAGACCCATTCTCGAGAATGGGTCTGGAGACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023910.4-1821s1c1
Sequence:CCGGTCCATAAGTCTCCAGACCCATCTCGAGATGGGTCTGGAGACTTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023910.4-1936s1c1
Sequence:CCGGCCTGGTTGGCATTGACAACAACTCGAGTTGTTGTCAATGCCAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023910.4-1290s1c1
Sequence:CCGGCGTGTGTGGATGTTTACAAGACTCGAGTCTTGTAAACATCCACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-1610s21c1
Sequence:GTACCGGTTGGCATTGACAACAAGATTGCTCGAGCAATCTTGTTGTCAATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-2053s21c1
Sequence:CCGGCAGCTCGGGAGAGGGTATTTACTCGAGTAAATACCCTCTCCCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-1492s21c1
Sequence:CCGGCATAAGTCTCCAGACCCATTTCTCGAGAAATGGGTCTGGAGACTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-1074s21c1
Sequence:CCGGGCTGGCTAGTTTGGGCATAAGCTCGAGCTTATGCCCAAACTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-922s21c1
Sequence:CCGGCAAGGTTTGGGAGAGCCTTATCTCGAGATAAGGCTCTCCCAAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023910
VALIDATED
TSC22D4 MISSION shRNA Lentiviral Transduction Particles
TSC22 domain family, member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023910.4-2490s1c1
Sequence:CCGGGCCTGGAAAGATTTGGAGGTTCTCGAGAACCTCCAAATCTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023910.4-1822s1c1
Sequence:CCGGCCATAAGTCTCCAGACCCATTCTCGAGAATGGGTCTGGAGACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023910.4-1821s1c1
Sequence:CCGGTCCATAAGTCTCCAGACCCATCTCGAGATGGGTCTGGAGACTTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023910.4-1936s1c1
Sequence:CCGGCCTGGTTGGCATTGACAACAACTCGAGTTGTTGTCAATGCCAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023910.4-1290s1c1
Sequence:CCGGCGTGTGTGGATGTTTACAAGACTCGAGTCTTGTAAACATCCACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-1610s21c1
Sequence:GTACCGGTTGGCATTGACAACAAGATTGCTCGAGCAATCTTGTTGTCAATGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-2053s21c1
Sequence:CCGGCAGCTCGGGAGAGGGTATTTACTCGAGTAAATACCCTCTCCCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-1492s21c1
Sequence:CCGGCATAAGTCTCCAGACCCATTTCTCGAGAAATGGGTCTGGAGACTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-1074s21c1
Sequence:CCGGGCTGGCTAGTTTGGGCATAAGCTCGAGCTTATGCCCAAACTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023910.5-922s21c1
Sequence:CCGGCAAGGTTTGGGAGAGCCTTATCTCGAGATAAGGCTCTCCCAAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030935
TSC22D4 MISSION shRNA Bacterial Glycerol Stock
TSC22 domain family, member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1604s1c1
Sequence:CCGGCGGAGCAGTAGCAGCTCAGAACTCGAGTTCTGAGCTGCTACTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-791s1c1
Sequence:CCGGCACCAGCGTCACCACGGACTACTCGAGTAGTCCGTGGTGACGCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1454s1c1
Sequence:CCGGCCGGAGGAAAGCTGTAGACATCTCGAGATGTCTACAGCTTTCCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1022s1c1
Sequence:CCGGCTGGACGTGTGTGGATGTTTACTCGAGTAAACATCCACACACGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1577s1c1
Sequence:CCGGCCTGGTTCACAAATCTCCAGACTCGAGTCTGGAGATTTGTGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030935.3-1740s21c1
Sequence:CCGGGTGAAGTCCCACCTCATGTTTCTCGAGAAACATGAGGTGGGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030935.3-2047s21c1
Sequence:CCGGGAGTTCAAGGCTCAGTAATGGCTCGAGCCATTACTGAGCCTTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030935
TSC22D4 MISSION shRNA shRNA Plasmid DNA
TSC22 domain family, member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1604s1c1
Sequence:CCGGCGGAGCAGTAGCAGCTCAGAACTCGAGTTCTGAGCTGCTACTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-791s1c1
Sequence:CCGGCACCAGCGTCACCACGGACTACTCGAGTAGTCCGTGGTGACGCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1454s1c1
Sequence:CCGGCCGGAGGAAAGCTGTAGACATCTCGAGATGTCTACAGCTTTCCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1022s1c1
Sequence:CCGGCTGGACGTGTGTGGATGTTTACTCGAGTAAACATCCACACACGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1577s1c1
Sequence:CCGGCCTGGTTCACAAATCTCCAGACTCGAGTCTGGAGATTTGTGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030935.3-1740s21c1
Sequence:CCGGGTGAAGTCCCACCTCATGTTTCTCGAGAAACATGAGGTGGGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030935.3-2047s21c1
Sequence:CCGGGAGTTCAAGGCTCAGTAATGGCTCGAGCCATTACTGAGCCTTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030935
TSC22D4 MISSION shRNA Lentiviral Transduction Particles
TSC22 domain family, member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1604s1c1
Sequence:CCGGCGGAGCAGTAGCAGCTCAGAACTCGAGTTCTGAGCTGCTACTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-791s1c1
Sequence:CCGGCACCAGCGTCACCACGGACTACTCGAGTAGTCCGTGGTGACGCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1454s1c1
Sequence:CCGGCCGGAGGAAAGCTGTAGACATCTCGAGATGTCTACAGCTTTCCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1022s1c1
Sequence:CCGGCTGGACGTGTGTGGATGTTTACTCGAGTAAACATCCACACACGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030935.3-1577s1c1
Sequence:CCGGCCTGGTTCACAAATCTCCAGACTCGAGTCTGGAGATTTGTGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030935.3-1740s21c1
Sequence:CCGGGTGAAGTCCCACCTCATGTTTCTCGAGAAACATGAGGTGGGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030935.3-2047s21c1
Sequence:CCGGGAGTTCAAGGCTCAGTAATGGCTCGAGCCATTACTGAGCCTTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks