EMAIL THIS PAGE TO A FRIEND

TSC2

tuberous sclerosis 2

Synonyms: LAM TSC4
Gene ID:
Human(7249) Summary: Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(22084) tuberous sclerosis 2
Rat(24855) tuberous sclerosis 2
Zebrafish(567524) tuberous sclerosis 2
dog(479883) tuberous sclerosis 2
Horse(100065679) tuberous sclerosis 2
domestic cat(101082969) tuberous sclerosis 2
chicken(416552) tuberous sclerosis 2
cow(504985) tuberous sclerosis 2
sheep(101115088) tuberous sclerosis 2
Goat(100860943) tuberous sclerosis 2
naked mole-rat(101713968) tuberous sclerosis 2
domestic guinea pig(100731690) tuberous sclerosis 2
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504003 Anti-phospho-Tuberin/TSC2 (pSer939) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504004 Anti-phospho-Tuberin/TSC2 (pThr1462) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
PRS3507 Anti-TSC2 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, western blot pricing
PRS3509 Anti-TSC2 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, western blot pricing
HPA030409 Anti-TSC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503037 Anti-TSC2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
HPA049679 Anti-TSC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4503038 Anti-TSC2, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
T5075 Anti-Tuberin (VV-18) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunoprecipitation, western blot pricing
SAB4503039 Anti-Tuberin antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB1402949 Monoclonal Anti-TSC2 antibody produced in mouse clone 1C1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000548 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000548 Rosetta Predictions human pricing
NM_001077183 Rosetta Predictions human pricing
NM_001114382 Rosetta Predictions human pricing
NM_021055 Rosetta Predictions human pricing
NM_021056 Rosetta Predictions human pricing
NM_012680 Rosetta Predictions rat pricing
NM_001039363 Rosetta Predictions mouse pricing
NM_011647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127335 predicted 5082
2 SASI_Hs01_00127336 predicted 3284
3 SASI_Hs01_00127337 predicted 2673
4 SASI_Hs01_00127338 predicted 1177
5 SASI_Hs01_00127339 predicted 4534
6 SASI_Hs01_00127340 predicted 542
7 SASI_Hs01_00127341 predicted 4654
8 SASI_Hs01_00127342 predicted 2248
9 SASI_Hs01_00127343 predicted 4473
10 SASI_Hs01_00127344 predicted 2416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312104 predicted 4883
2 SASI_Hs02_00312105 predicted 3160
3 SASI_Hs02_00312106 predicted 2677
4 SASI_Hs02_00312107 predicted 1172
5 SASI_Hs02_00312108 predicted 4330
6 SASI_Hs02_00312109 predicted 541
7 SASI_Hs02_00312110 predicted 4448
8 SASI_Hs02_00312111 predicted 2254
9 SASI_Hs02_00312112 predicted 4279
10 SASI_Hs02_00312113 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326554 predicted 5009
2 SASI_Hs02_00326555 predicted 3287
3 SASI_Hs02_00326556 predicted 2675
4 SASI_Hs02_00326557 predicted 1171
5 SASI_Hs02_00326558 predicted 4463
6 SASI_Hs02_00326559 predicted 543
7 SASI_Hs02_00326560 predicted 4584
8 SASI_Hs02_00326561 predicted 2251
9 SASI_Hs02_00326562 predicted 4403
10 SASI_Hs02_00326563 predicted 2408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016375 predicted 4869
2 SASI_Hs01_00016376 predicted 3079
3 SASI_Hs01_00016377 predicted 2595
4 SASI_Hs01_00016378 predicted 1092
5 SASI_Hs01_00016379 predicted 4327
6 SASI_Hs01_00016380 predicted 454
7 SASI_Hs01_00016381 predicted 4438
8 SASI_Hs01_00016382 predicted 2167
9 SASI_Hs01_00016383 predicted 4269
10 SASI_Hs01_00016384 predicted 2331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067215 predicted 4869
2 SASI_Hs01_00067216 predicted 3076
3 SASI_Hs01_00067217 predicted 2595
4 SASI_Hs01_00067218 predicted 1089
5 SASI_Hs01_00067219 predicted 4316
6 SASI_Hs01_00067220 predicted 461
7 SASI_Hs01_00067221 predicted 4438
8 SASI_Hs01_00067222 predicted 2168
9 SASI_Hs01_00067223 predicted 4261
10 SASI_Hs01_00067224 predicted 2325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033761 predicted 1090
2 SASI_Rn01_00033762 predicted 3266
3 SASI_Rn01_00033763 predicted 678
4 SASI_Rn01_00033764 predicted 464
5 SASI_Rn02_00259966 predicted 1833
6 SASI_Rn01_00033766 predicted 3171
7 SASI_Rn02_00259967 predicted 1338
8 SASI_Rn01_00033768 predicted 4470
9 SASI_Rn02_00259968 predicted 4699
10 SASI_Rn01_00033769 predicted 2408
11 SASI_Rn01_00033765 predicted 530
12 SASI_Rn01_00033767 predicted 1032
13 SASI_Rn01_00033770 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052652 predicted 1128
2 SASI_Mm01_00052653 predicted 523
3 SASI_Mm01_00052654 predicted 4517
4 SASI_Mm01_00052655 predicted 429
5 SASI_Mm01_00052656 predicted 4475
6 SASI_Mm01_00052657 predicted 1067
7 SASI_Mm01_00052658 predicted 3684
8 SASI_Mm01_00052659 predicted 1505
9 SASI_Mm02_00290018 predicted 1002
10 SASI_Mm01_00052660 predicted 4414
11 SASI_Mm01_00052661 predicted 1883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080985 predicted 1128
2 SASI_Mm01_00080986 predicted 524
3 SASI_Mm01_00080987 predicted 4642
4 SASI_Mm01_00080988 predicted 429
5 SASI_Mm01_00080989 predicted 4598
6 SASI_Mm01_00080990 predicted 1065
7 SASI_Mm01_00080991 predicted 3822
8 SASI_Mm01_00080992 predicted 1499
9 SASI_Mm02_00321121 predicted 999
10 SASI_Mm01_00080993 predicted 4535
11 SASI_Mm01_00080994 predicted 1882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011647
VALIDATED
TSC2 MISSION shRNA Bacterial Glycerol Stock
tuberous sclerosis 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011647.1-3181s1c1
Sequence:CCGGGCCCGATATGTGTTCTCCAATCTCGAGATTGGAGAACACATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011647.1-1352s1c1
Sequence:CCGGCCTCTCTCTTAAACTTGATATCTCGAGATATCAAGTTTAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011647.1-3640s1c1
Sequence:CCGGGCAGCCTATGTGCCTTTGTTACTCGAGTAACAAAGGCACATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011647.1-1843s1c1
Sequence:CCGGCGAGTGTATGAGAGCCTCATTCTCGAGAATGAGGCTCTCATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011647.1-2817s1c1
Sequence:CCGGCCCTTATATCACTAAGGGTTTCTCGAGAAACCCTTAGTGATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-1874s21c1
Sequence:CCGGCGAGTGTATGAGAGCCTCATTCTCGAGAATGAGGCTCTCATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-3212s21c1
Sequence:CCGGGCCCGATATGTGTTCTCCAATCTCGAGATTGGAGAACACATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-5280s21c1
Sequence:CCGGTCGCAAGACTCCGCCACATTACTCGAGTAATGTGGCGGAGTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011647.2-5532s21c1
Sequence:CCGGCTGTACTCCTACATGAAATAACTCGAGTTATTTCATGTAGGAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-1383s21c1
Sequence:CCGGCCTCTCTCTTAAACTTGATATCTCGAGATATCAAGTTTAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011647
VALIDATED
TSC2 MISSION shRNA shRNA Plasmid DNA
tuberous sclerosis 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011647.1-3181s1c1
Sequence:CCGGGCCCGATATGTGTTCTCCAATCTCGAGATTGGAGAACACATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011647.1-1352s1c1
Sequence:CCGGCCTCTCTCTTAAACTTGATATCTCGAGATATCAAGTTTAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011647.1-3640s1c1
Sequence:CCGGGCAGCCTATGTGCCTTTGTTACTCGAGTAACAAAGGCACATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011647.1-1843s1c1
Sequence:CCGGCGAGTGTATGAGAGCCTCATTCTCGAGAATGAGGCTCTCATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011647.1-2817s1c1
Sequence:CCGGCCCTTATATCACTAAGGGTTTCTCGAGAAACCCTTAGTGATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-1874s21c1
Sequence:CCGGCGAGTGTATGAGAGCCTCATTCTCGAGAATGAGGCTCTCATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-3212s21c1
Sequence:CCGGGCCCGATATGTGTTCTCCAATCTCGAGATTGGAGAACACATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-5280s21c1
Sequence:CCGGTCGCAAGACTCCGCCACATTACTCGAGTAATGTGGCGGAGTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011647.2-5532s21c1
Sequence:CCGGCTGTACTCCTACATGAAATAACTCGAGTTATTTCATGTAGGAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-1383s21c1
Sequence:CCGGCCTCTCTCTTAAACTTGATATCTCGAGATATCAAGTTTAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011647
VALIDATED
TSC2 MISSION shRNA Lentiviral Transduction Particles
tuberous sclerosis 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011647.1-3181s1c1
Sequence:CCGGGCCCGATATGTGTTCTCCAATCTCGAGATTGGAGAACACATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011647.1-1352s1c1
Sequence:CCGGCCTCTCTCTTAAACTTGATATCTCGAGATATCAAGTTTAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011647.1-3640s1c1
Sequence:CCGGGCAGCCTATGTGCCTTTGTTACTCGAGTAACAAAGGCACATAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011647.1-1843s1c1
Sequence:CCGGCGAGTGTATGAGAGCCTCATTCTCGAGAATGAGGCTCTCATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011647.1-2817s1c1
Sequence:CCGGCCCTTATATCACTAAGGGTTTCTCGAGAAACCCTTAGTGATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-1874s21c1
Sequence:CCGGCGAGTGTATGAGAGCCTCATTCTCGAGAATGAGGCTCTCATACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-3212s21c1
Sequence:CCGGGCCCGATATGTGTTCTCCAATCTCGAGATTGGAGAACACATATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-5280s21c1
Sequence:CCGGTCGCAAGACTCCGCCACATTACTCGAGTAATGTGGCGGAGTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011647.2-5532s21c1
Sequence:CCGGCTGTACTCCTACATGAAATAACTCGAGTTATTTCATGTAGGAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011647.2-1383s21c1
Sequence:CCGGCCTCTCTCTTAAACTTGATATCTCGAGATATCAAGTTTAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000548
VALIDATED
TSC2 MISSION shRNA Bacterial Glycerol Stock
tuberous sclerosis 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-1437s1c1
Sequence:CCGGGCTCATCAACAGGCAGTTCTACTCGAGTAGAACTGCCTGTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-4551s1c1
Sequence:CCGGCGACGAGTCAAACAAGCCAATCTCGAGATTGGCTTGTTTGACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000548.2-2170s1c1
Sequence:CCGGCGCTATAAAGTGCTCATCTTTCTCGAGAAAGATGAGCACTTTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-112s1c1
Sequence:CCGGGAGGGTAAACAGACGGAGTTTCTCGAGAAACTCCGTCTGTTTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-413s1c1
Sequence:CCGGCCAACGAAGACCTTCACGAAACTCGAGTTTCGTGAAGGTCTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.x-2330s1c1
Sequence:CCGGCAGCATTAATCTCTTACCATACTCGAGTATGGTAAGAGATTAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.x-4581s1c1
Sequence:CCGGCAATGAGTCACAGTCCTTTGACTCGAGTCAAAGGACTGTGACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-2418s21c1
Sequence:CCGGCAGCATTAATCTCTTACCATACTCGAGTATGGTAAGAGATTAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-1525s21c1
Sequence:CCGGGCTCATCAACAGGCAGTTCTACTCGAGTAGAACTGCCTGTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-4639s21c1
Sequence:CCGGCGACGAGTCAAACAAGCCAATCTCGAGATTGGCTTGTTTGACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-200s21c1
Sequence:CCGGGAGGGTAAACAGACGGAGTTTCTCGAGAAACTCCGTCTGTTTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000548.3-4669s21c1
Sequence:CCGGCAATGAGTCACAGTCCTTTGACTCGAGTCAAAGGACTGTGACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000548
VALIDATED
TSC2 MISSION shRNA shRNA Plasmid DNA
tuberous sclerosis 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-1437s1c1
Sequence:CCGGGCTCATCAACAGGCAGTTCTACTCGAGTAGAACTGCCTGTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-4551s1c1
Sequence:CCGGCGACGAGTCAAACAAGCCAATCTCGAGATTGGCTTGTTTGACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000548.2-2170s1c1
Sequence:CCGGCGCTATAAAGTGCTCATCTTTCTCGAGAAAGATGAGCACTTTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-112s1c1
Sequence:CCGGGAGGGTAAACAGACGGAGTTTCTCGAGAAACTCCGTCTGTTTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-413s1c1
Sequence:CCGGCCAACGAAGACCTTCACGAAACTCGAGTTTCGTGAAGGTCTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.x-2330s1c1
Sequence:CCGGCAGCATTAATCTCTTACCATACTCGAGTATGGTAAGAGATTAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.x-4581s1c1
Sequence:CCGGCAATGAGTCACAGTCCTTTGACTCGAGTCAAAGGACTGTGACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-2418s21c1
Sequence:CCGGCAGCATTAATCTCTTACCATACTCGAGTATGGTAAGAGATTAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-1525s21c1
Sequence:CCGGGCTCATCAACAGGCAGTTCTACTCGAGTAGAACTGCCTGTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-4639s21c1
Sequence:CCGGCGACGAGTCAAACAAGCCAATCTCGAGATTGGCTTGTTTGACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-200s21c1
Sequence:CCGGGAGGGTAAACAGACGGAGTTTCTCGAGAAACTCCGTCTGTTTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000548.3-4669s21c1
Sequence:CCGGCAATGAGTCACAGTCCTTTGACTCGAGTCAAAGGACTGTGACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000548
VALIDATED
TSC2 MISSION shRNA Lentiviral Transduction Particles
tuberous sclerosis 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-1437s1c1
Sequence:CCGGGCTCATCAACAGGCAGTTCTACTCGAGTAGAACTGCCTGTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-4551s1c1
Sequence:CCGGCGACGAGTCAAACAAGCCAATCTCGAGATTGGCTTGTTTGACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000548.2-2170s1c1
Sequence:CCGGCGCTATAAAGTGCTCATCTTTCTCGAGAAAGATGAGCACTTTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-112s1c1
Sequence:CCGGGAGGGTAAACAGACGGAGTTTCTCGAGAAACTCCGTCTGTTTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.2-413s1c1
Sequence:CCGGCCAACGAAGACCTTCACGAAACTCGAGTTTCGTGAAGGTCTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.x-2330s1c1
Sequence:CCGGCAGCATTAATCTCTTACCATACTCGAGTATGGTAAGAGATTAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000548.x-4581s1c1
Sequence:CCGGCAATGAGTCACAGTCCTTTGACTCGAGTCAAAGGACTGTGACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-2418s21c1
Sequence:CCGGCAGCATTAATCTCTTACCATACTCGAGTATGGTAAGAGATTAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-1525s21c1
Sequence:CCGGGCTCATCAACAGGCAGTTCTACTCGAGTAGAACTGCCTGTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-4639s21c1
Sequence:CCGGCGACGAGTCAAACAAGCCAATCTCGAGATTGGCTTGTTTGACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000548.3-200s21c1
Sequence:CCGGGAGGGTAAACAGACGGAGTTTCTCGAGAAACTCCGTCTGTTTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000548.3-4669s21c1
Sequence:CCGGCAATGAGTCACAGTCCTTTGACTCGAGTCAAAGGACTGTGACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks