EMAIL THIS PAGE TO A FRIEND

TSEN15

TSEN15 tRNA splicing endonuclease subunit

Synonyms: C1orf19 sen15
UniProtKB ID: Q8WW01, B4DKP0, Q9BZQ5
Gene ID:
Human(116461) Summary: tRNA splicing is a fundamental process required for cell growth and division. SEN15 is a subunit of the tRNA splicing endonuclease, which catalyzes the removal of introns, the first step in tRNA splicing (Paushkin et al., 2004 [PubMed 15109492]
Mouse(66637) tRNA splicing endonuclease 15 homolog (S. cerevisiae)
Rat(289083) tRNA splicing endonuclease 15 homolog (S. cerevisiae)
cow(614118) tRNA splicing endonuclease 15 homolog (S. cerevisiae)
sheep(101107455) tRNA splicing endonuclease 15 homolog (S. cerevisiae)
domestic guinea pig(100716748) tRNA splicing endonuclease 15 homolog (S. cerevisiae)
naked mole-rat(101713423) tRNA splicing endonuclease 15 homolog (S. cerevisiae)
Zebrafish(100005064) tRNA splicing endonuclease 15 homolog (S. cerevisiae)
dog(610637) tRNA splicing endonuclease 15 homolog (S. cerevisiae)
chicken(424448) tRNA splicing endonuclease 15 homolog (S. cerevisiae)
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052965 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127394 Rosetta Predictions human pricing
NM_052965 Rosetta Predictions human pricing
NR_023349 Rosetta Predictions human pricing
NM_001105958 Rosetta Predictions rat pricing
NM_025677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329414 predicted 203
2 SASI_Hs02_00329415 predicted 200
3 SASI_Hs02_00329416 predicted 857
4 SASI_Hs02_00329417 predicted 696
5 SASI_Hs02_00329418 predicted 888
6 SASI_Hs02_00329419 predicted 672
7 SASI_Hs02_00329420 predicted 757
8 SASI_Hs02_00329421 predicted 791
9 SASI_Hs02_00329422 predicted 701
10 SASI_Hs02_00329423 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361770 predicted 198
2 SASI_Hs02_00361771 predicted 202
3 SASI_Hs02_00361772 predicted 999
4 SASI_Hs02_00361773 predicted 833
5 SASI_Hs01_00045562 predicted 1030
6 SASI_Hs02_00361774 predicted 811
7 SASI_Hs02_00361775 predicted 899
8 SASI_Hs02_00361776 predicted 931
9 SASI_Hs02_00361777 predicted 847
10 SASI_Hs02_00361778 predicted 195
11 SASI_Hs01_00045559 predicted 548
12 SASI_Hs01_00045560 predicted 575
13 SASI_Hs01_00045561 predicted 642
14 SASI_Hs01_00045563 predicted 480
15 SASI_Hs01_00045564 predicted 320
16 SASI_Hs01_00045565 predicted 608
17 SASI_Hs01_00045566 predicted 774
18 SASI_Hs01_00045567 predicted 817
19 SASI_Hs01_00045568 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381742 predicted 685
2 SASI_Hs02_00381743 predicted 711
3 SASI_Hs02_00381744 predicted 790
4 SASI_Hs02_00381745 predicted 1149
5 SASI_Hs02_00381746 predicted 1014
6 SASI_Hs02_00381747 predicted 618
7 SASI_Hs02_00381748 predicted 1055
8 SASI_Hs02_00381749 predicted 344
9 SASI_Hs02_00381750 predicted 225
10 SASI_Hs02_00381751 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214222 predicted 637
2 SASI_Rn02_00214223 predicted 552
3 SASI_Rn02_00214224 predicted 426
4 SASI_Rn02_00214225 predicted 555
5 SASI_Rn02_00214226 predicted 471
6 SASI_Rn02_00214227 predicted 433
7 SASI_Rn02_00214228 predicted 600
8 SASI_Rn02_00214229 predicted 567
9 SASI_Rn02_00214230 predicted 283
10 SASI_Rn02_00214231 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043340 predicted 212
2 SASI_Mm01_00043341 predicted 782
3 SASI_Mm01_00043342 predicted 580
4 SASI_Mm01_00043343 predicted 691
5 SASI_Mm02_00328823 predicted 696
6 SASI_Mm01_00043344 predicted 479
7 SASI_Mm01_00043345 predicted 424
8 SASI_Mm01_00043346 predicted 533
9 SASI_Mm01_00043348 predicted 312
10 SASI_Mm01_00043349 predicted 234
11 SASI_Mm01_00043347 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052965
VALIDATED
TSEN15 MISSION shRNA Bacterial Glycerol Stock
TSEN15 tRNA splicing endonuclease subunit
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052965.2-198s21c1
Sequence:CCGGTGGGCACTCACCCTAAGTATCCTCGAGGATACTTAGGGTGAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052965.2-463s21c1
Sequence:CCGGGTTGCAAGGTGATCCAGATTTCTCGAGAAATCTGGATCACCTTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052965.2-829s21c1
Sequence:CCGGACAGTTATATACAGGTTTATGCTCGAGCATAAACCTGTATATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052965.2-561s21c1
Sequence:CCGGTGCCAGACCCTCAGAATATTTCTCGAGAAATATTCTGAGGGTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052965.2-999s21c1
Sequence:CCGGCACTGCAGCTACCGTAGAATGCTCGAGCATTCTACGGTAGCTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052965.2-516s21c1
Sequence:CCGGCTGATTCTACAATAGTCTATTCTCGAGAATAGACTATTGTAGAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052965.1-1569s1c1
Sequence:CCGGGCGTGGCTTTGTTCCAGTAAACTCGAGTTTACTGGAACAAAGCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052965.1-395s1c1
Sequence:CCGGCCATAACAGGATAAGGGAGATCTCGAGATCTCCCTTATCCTGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052965.1-869s1c1
Sequence:CCGGCCACACTCAAAGTTGTCTCTTCTCGAGAAGAGACAACTTTGAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052965.1-223s1c1
Sequence:CCGGCCCAAGTTTATGTAGCGTTCTCTCGAGAGAACGCTACATAAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052965.1-224s1c1
Sequence:CCGGCCAAGTTTATGTAGCGTTCTTCTCGAGAAGAACGCTACATAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052965.1-282s1c1
Sequence:CCGGGAAGTAAACTGTGTAGGATTACTCGAGTAATCCTACACAGTTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052965
VALIDATED
TSEN15 MISSION shRNA shRNA Plasmid DNA
TSEN15 tRNA splicing endonuclease subunit
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052965.2-198s21c1
Sequence:CCGGTGGGCACTCACCCTAAGTATCCTCGAGGATACTTAGGGTGAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052965.2-463s21c1
Sequence:CCGGGTTGCAAGGTGATCCAGATTTCTCGAGAAATCTGGATCACCTTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052965.2-829s21c1
Sequence:CCGGACAGTTATATACAGGTTTATGCTCGAGCATAAACCTGTATATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052965.2-561s21c1
Sequence:CCGGTGCCAGACCCTCAGAATATTTCTCGAGAAATATTCTGAGGGTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052965.2-999s21c1
Sequence:CCGGCACTGCAGCTACCGTAGAATGCTCGAGCATTCTACGGTAGCTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052965.2-516s21c1
Sequence:CCGGCTGATTCTACAATAGTCTATTCTCGAGAATAGACTATTGTAGAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052965.1-1569s1c1
Sequence:CCGGGCGTGGCTTTGTTCCAGTAAACTCGAGTTTACTGGAACAAAGCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052965.1-395s1c1
Sequence:CCGGCCATAACAGGATAAGGGAGATCTCGAGATCTCCCTTATCCTGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052965.1-869s1c1
Sequence:CCGGCCACACTCAAAGTTGTCTCTTCTCGAGAAGAGACAACTTTGAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052965.1-223s1c1
Sequence:CCGGCCCAAGTTTATGTAGCGTTCTCTCGAGAGAACGCTACATAAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052965.1-224s1c1
Sequence:CCGGCCAAGTTTATGTAGCGTTCTTCTCGAGAAGAACGCTACATAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052965.1-282s1c1
Sequence:CCGGGAAGTAAACTGTGTAGGATTACTCGAGTAATCCTACACAGTTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052965
VALIDATED
TSEN15 MISSION shRNA Lentiviral Transduction Particles
TSEN15 tRNA splicing endonuclease subunit
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052965.2-198s21c1
Sequence:CCGGTGGGCACTCACCCTAAGTATCCTCGAGGATACTTAGGGTGAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052965.2-463s21c1
Sequence:CCGGGTTGCAAGGTGATCCAGATTTCTCGAGAAATCTGGATCACCTTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052965.2-829s21c1
Sequence:CCGGACAGTTATATACAGGTTTATGCTCGAGCATAAACCTGTATATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052965.2-561s21c1
Sequence:CCGGTGCCAGACCCTCAGAATATTTCTCGAGAAATATTCTGAGGGTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_052965.2-999s21c1
Sequence:CCGGCACTGCAGCTACCGTAGAATGCTCGAGCATTCTACGGTAGCTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052965.2-516s21c1
Sequence:CCGGCTGATTCTACAATAGTCTATTCTCGAGAATAGACTATTGTAGAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163743    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052965.1-1569s1c1
Sequence:CCGGGCGTGGCTTTGTTCCAGTAAACTCGAGTTTACTGGAACAAAGCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052965.1-395s1c1
Sequence:CCGGCCATAACAGGATAAGGGAGATCTCGAGATCTCCCTTATCCTGTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052965.1-869s1c1
Sequence:CCGGCCACACTCAAAGTTGTCTCTTCTCGAGAAGAGACAACTTTGAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052965.1-223s1c1
Sequence:CCGGCCCAAGTTTATGTAGCGTTCTCTCGAGAGAACGCTACATAAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052965.1-224s1c1
Sequence:CCGGCCAAGTTTATGTAGCGTTCTTCTCGAGAAGAACGCTACATAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052965.1-282s1c1
Sequence:CCGGGAAGTAAACTGTGTAGGATTACTCGAGTAATCCTACACAGTTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025677
TSEN15 MISSION shRNA Bacterial Glycerol Stock
TSEN15 tRNA splicing endonuclease subunit
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-208s21c1
Sequence:CCGGTGGGCACACACCCTAAGTATTCTCGAGAATACTTAGGGTGTGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025677.2-528s1c1
Sequence:CCGGGATTCCACAATAGTCTATTATCTCGAGATAATAGACTATTGTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-528s21c1
Sequence:CCGGGATTCCACAATAGTCTATTATCTCGAGATAATAGACTATTGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-422s21c1
Sequence:CCGGTGCTTCCCTCAGCCATAATAGCTCGAGCTATTATGGCTGAGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025677.2-706s21c1
Sequence:CCGGTAGCTAGTCCCAACCCATAAACTCGAGTTTATGGGTTGGGACTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-571s21c1
Sequence:CCGGTGCCAGACCCTCAGAATATTTCTCGAGAAATATTCTGAGGGTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025677.1-277s1c1
Sequence:CCGGGCATTCTTGGTTTACCTGGATCTCGAGATCCAGGTAAACCAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025677.1-334s1c1
Sequence:CCGGGTAGGAATACCAGAACTACAACTCGAGTTGTAGTTCTGGTATTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025677
TSEN15 MISSION shRNA shRNA Plasmid DNA
TSEN15 tRNA splicing endonuclease subunit
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-208s21c1
Sequence:CCGGTGGGCACACACCCTAAGTATTCTCGAGAATACTTAGGGTGTGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025677.2-528s1c1
Sequence:CCGGGATTCCACAATAGTCTATTATCTCGAGATAATAGACTATTGTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-528s21c1
Sequence:CCGGGATTCCACAATAGTCTATTATCTCGAGATAATAGACTATTGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-422s21c1
Sequence:CCGGTGCTTCCCTCAGCCATAATAGCTCGAGCTATTATGGCTGAGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025677.2-706s21c1
Sequence:CCGGTAGCTAGTCCCAACCCATAAACTCGAGTTTATGGGTTGGGACTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-571s21c1
Sequence:CCGGTGCCAGACCCTCAGAATATTTCTCGAGAAATATTCTGAGGGTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025677.1-277s1c1
Sequence:CCGGGCATTCTTGGTTTACCTGGATCTCGAGATCCAGGTAAACCAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025677.1-334s1c1
Sequence:CCGGGTAGGAATACCAGAACTACAACTCGAGTTGTAGTTCTGGTATTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025677
TSEN15 MISSION shRNA Lentiviral Transduction Particles
TSEN15 tRNA splicing endonuclease subunit
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-208s21c1
Sequence:CCGGTGGGCACACACCCTAAGTATTCTCGAGAATACTTAGGGTGTGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025677.2-528s1c1
Sequence:CCGGGATTCCACAATAGTCTATTATCTCGAGATAATAGACTATTGTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-528s21c1
Sequence:CCGGGATTCCACAATAGTCTATTATCTCGAGATAATAGACTATTGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-422s21c1
Sequence:CCGGTGCTTCCCTCAGCCATAATAGCTCGAGCTATTATGGCTGAGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025677.2-706s21c1
Sequence:CCGGTAGCTAGTCCCAACCCATAAACTCGAGTTTATGGGTTGGGACTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025677.2-571s21c1
Sequence:CCGGTGCCAGACCCTCAGAATATTTCTCGAGAAATATTCTGAGGGTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025677.1-277s1c1
Sequence:CCGGGCATTCTTGGTTTACCTGGATCTCGAGATCCAGGTAAACCAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025677.1-334s1c1
Sequence:CCGGGTAGGAATACCAGAACTACAACTCGAGTTGTAGTTCTGGTATTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks