EMAIL THIS PAGE TO A FRIEND

TSEN2

TSEN2 tRNA splicing endonuclease subunit

Synonyms: PCH2B SEN2 SEN2L
UniProtKB ID: Q8NCE0, B7Z6K1, C9IZI7, G5E9Q3, Q8WTW7, Q9BPU7
Gene ID:
Human(80746) Summary: This gene encodes one of the subunits of the tRNA splicing endonuclease. This endonuclease catalyzes the first step in RNA splicing which is the removal of introns. Mutations in this gene have been associated with pontocerebellar hypoplasia type 2. A pseudogene has been identified on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
Mouse(381802) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
Rat(312649) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
Zebrafish(767713) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
chicken(415965) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
dog(484651) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
Horse(100051185) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
domestic cat(101095562) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
naked mole-rat(101709309) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
Domestic Rabbit(100340660) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
domestic guinea pig(100728855) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
cow(515511) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
sheep(101104017) tRNA splicing endonuclease 2 homolog (S. cerevisiae)
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025265 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025265 Rosetta Predictions human pricing
NM_001014057 Rosetta Predictions rat pricing
XM_001053699 Rosetta Predictions rat pricing
NM_199033 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176120 predicted 1600
2 SASI_Hs01_00176121 predicted 543
3 SASI_Hs01_00176122 predicted 402
4 SASI_Hs01_00176123 predicted 1233
5 SASI_Hs01_00176124 predicted 1494
6 SASI_Hs01_00176125 predicted 1684
7 SASI_Hs02_00358118 predicted 623
8 SASI_Hs01_00176127 predicted 821
9 SASI_Hs01_00176128 predicted 1290
10 SASI_Hs01_00176129 predicted 675
11 SASI_Hs01_00176126 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102227 predicted 1512
2 SASI_Rn01_00102228 predicted 1047
3 SASI_Rn01_00102229 predicted 1158
4 SASI_Rn01_00102230 predicted 1116
5 SASI_Rn01_00102231 predicted 894
6 SASI_Rn01_00102232 predicted 1430
7 SASI_Rn02_00201450 predicted 1389
8 SASI_Rn01_00102233 predicted 957
9 SASI_Rn01_00102235 predicted 1522
10 SASI_Rn02_00201451 predicted 372
11 SASI_Rn01_00102234 predicted 974
12 SASI_Rn01_00102236 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273269 predicted 1497
2 SASI_Rn02_00273270 predicted 1048
3 SASI_Rn02_00273271 predicted 889
4 SASI_Rn02_00273272 predicted 1404
5 SASI_Rn02_00273273 predicted 1371
6 SASI_Rn02_00273274 predicted 956
7 SASI_Rn02_00273275 predicted 1506
8 SASI_Rn02_00273276 predicted 366
9 SASI_Rn02_00273277 predicted 566
10 SASI_Rn02_00273278 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045732 predicted 891
2 SASI_Mm02_00351312 predicted 905
3 SASI_Mm01_00045733 predicted 329
4 SASI_Mm01_00045734 predicted 1150
5 SASI_Mm01_00045735 predicted 966
6 SASI_Mm01_00045736 predicted 1345
7 SASI_Mm01_00045737 predicted 893
8 SASI_Mm01_00045739 predicted 665
9 SASI_Mm01_00045740 predicted 1002
10 SASI_Mm01_00045741 predicted 869
11 SASI_Mm01_00045738 predicted 1345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199033
TSEN2 MISSION shRNA Bacterial Glycerol Stock
TSEN2 tRNA splicing endonuclease subunit
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199033.1-1406s1c1
Sequence:CCGGGAAGTGACCAAGATGAGCTTTCTCGAGAAAGCTCATCTTGGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199033.1-1281s1c1
Sequence:CCGGGCTGATGCTGTGTTATTTGATCTCGAGATCAAATAACACAGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199033.1-1614s1c1
Sequence:CCGGCATTGACGGTTTGGAAACCTTCTCGAGAAGGTTTCCAAACCGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199033.1-1162s1c1
Sequence:CCGGGCAAGCTACTCGGTCATCATTCTCGAGAATGATGACCGAGTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199033
TSEN2 MISSION shRNA shRNA Plasmid DNA
TSEN2 tRNA splicing endonuclease subunit
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199033.1-1406s1c1
Sequence:CCGGGAAGTGACCAAGATGAGCTTTCTCGAGAAAGCTCATCTTGGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199033.1-1281s1c1
Sequence:CCGGGCTGATGCTGTGTTATTTGATCTCGAGATCAAATAACACAGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199033.1-1614s1c1
Sequence:CCGGCATTGACGGTTTGGAAACCTTCTCGAGAAGGTTTCCAAACCGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199033.1-1162s1c1
Sequence:CCGGGCAAGCTACTCGGTCATCATTCTCGAGAATGATGACCGAGTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199033
TSEN2 MISSION shRNA Lentiviral Transduction Particles
TSEN2 tRNA splicing endonuclease subunit
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199033.1-1406s1c1
Sequence:CCGGGAAGTGACCAAGATGAGCTTTCTCGAGAAAGCTCATCTTGGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199033.1-1281s1c1
Sequence:CCGGGCTGATGCTGTGTTATTTGATCTCGAGATCAAATAACACAGCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199033.1-1614s1c1
Sequence:CCGGCATTGACGGTTTGGAAACCTTCTCGAGAAGGTTTCCAAACCGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199033.1-1162s1c1
Sequence:CCGGGCAAGCTACTCGGTCATCATTCTCGAGAATGATGACCGAGTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025265
TSEN2 MISSION shRNA Bacterial Glycerol Stock
TSEN2 tRNA splicing endonuclease subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-1497s1c1
Sequence:CCGGCCATGCAAGTTATTCTGTCATCTCGAGATGACAGAATAACTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-489s1c1
Sequence:CCGGCCGTGCTGAAATGATTAACAACTCGAGTTGTTAATCATTTCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-543s1c1
Sequence:CCGGGCAGCTCTATGGGAAAGGTTACTCGAGTAACCTTTCCCATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-1215s1c1
Sequence:CCGGCAGGTTAATATGCAGAAGAAACTCGAGTTTCTTCTGCATATTAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-1586s1c1
Sequence:CCGGCCTTGAGCAGAGTTTCCGTTACTCGAGTAACGGAAACTCTGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025265.3-1258s21c1
Sequence:CCGGTATAGGATCTTTGAGTATTTGCTCGAGCAAATACTCAAAGATCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025265.3-631s21c1
Sequence:CCGGGATCCTAAACTGGTTGCTAAACTCGAGTTTAGCAACCAGTTTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025265.3-1764s21c1
Sequence:CCGGGAGTGACCAAGACGATCTTTACTCGAGTAAAGATCGTCTTGGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025265.3-1852s21c1
Sequence:CCGGTTGTTGTAATCGTCCATTAATCTCGAGATTAATGGACGATTACAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025265
TSEN2 MISSION shRNA shRNA Plasmid DNA
TSEN2 tRNA splicing endonuclease subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-1497s1c1
Sequence:CCGGCCATGCAAGTTATTCTGTCATCTCGAGATGACAGAATAACTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-489s1c1
Sequence:CCGGCCGTGCTGAAATGATTAACAACTCGAGTTGTTAATCATTTCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-543s1c1
Sequence:CCGGGCAGCTCTATGGGAAAGGTTACTCGAGTAACCTTTCCCATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-1215s1c1
Sequence:CCGGCAGGTTAATATGCAGAAGAAACTCGAGTTTCTTCTGCATATTAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-1586s1c1
Sequence:CCGGCCTTGAGCAGAGTTTCCGTTACTCGAGTAACGGAAACTCTGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025265.3-1258s21c1
Sequence:CCGGTATAGGATCTTTGAGTATTTGCTCGAGCAAATACTCAAAGATCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025265.3-631s21c1
Sequence:CCGGGATCCTAAACTGGTTGCTAAACTCGAGTTTAGCAACCAGTTTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025265.3-1764s21c1
Sequence:CCGGGAGTGACCAAGACGATCTTTACTCGAGTAAAGATCGTCTTGGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025265.3-1852s21c1
Sequence:CCGGTTGTTGTAATCGTCCATTAATCTCGAGATTAATGGACGATTACAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025265
TSEN2 MISSION shRNA Lentiviral Transduction Particles
TSEN2 tRNA splicing endonuclease subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-1497s1c1
Sequence:CCGGCCATGCAAGTTATTCTGTCATCTCGAGATGACAGAATAACTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-489s1c1
Sequence:CCGGCCGTGCTGAAATGATTAACAACTCGAGTTGTTAATCATTTCAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-543s1c1
Sequence:CCGGGCAGCTCTATGGGAAAGGTTACTCGAGTAACCTTTCCCATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-1215s1c1
Sequence:CCGGCAGGTTAATATGCAGAAGAAACTCGAGTTTCTTCTGCATATTAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025265.2-1586s1c1
Sequence:CCGGCCTTGAGCAGAGTTTCCGTTACTCGAGTAACGGAAACTCTGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025265.3-1258s21c1
Sequence:CCGGTATAGGATCTTTGAGTATTTGCTCGAGCAAATACTCAAAGATCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025265.3-631s21c1
Sequence:CCGGGATCCTAAACTGGTTGCTAAACTCGAGTTTAGCAACCAGTTTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025265.3-1764s21c1
Sequence:CCGGGAGTGACCAAGACGATCTTTACTCGAGTAAAGATCGTCTTGGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025265.3-1852s21c1
Sequence:CCGGTTGTTGTAATCGTCCATTAATCTCGAGATTAATGGACGATTACAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks