EMAIL THIS PAGE TO A FRIEND

TSEN34

TSEN34 tRNA splicing endonuclease subunit

Synonyms: LENG5 PCH2C SEN34 SEN34L
UniProtKB ID: Q9BSV6, A6NNB1, B0V3J1, Q9BVT1, Q9H6H5
Gene ID:
Human(79042) Summary: This gene encodes a catalytic subunit of the tRNA splicing endonuclease, which catalyzes the removal of introns from precursor tRNAs. The endonuclease complex is also associated with a pre-mRNA 3-prime end processing factor. A mutation in this gene results in the neurological disorder pontocerebellar hypoplasia type 2. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Oct 2009]
Mouse(66078) tRNA splicing endonuclease 34 homolog (S. cerevisiae)
Rat(292534) tRNA splicing endonuclease 34 homolog (S. cerevisiae)
Zebrafish(565995) tRNA splicing endonuclease 34 homolog (S. cerevisiae)
chicken(100859368) tRNA splicing endonuclease 34 homolog (S. cerevisiae)
domestic cat(101081426) tRNA splicing endonuclease 34 homolog (S. cerevisiae)
dog(611457) tRNA splicing endonuclease 34 homolog (S. cerevisiae)
cow(505571) tRNA splicing endonuclease 34 homolog (S. cerevisiae)
sheep(101107041) tRNA splicing endonuclease 34 homolog (S. cerevisiae)
domestic guinea pig(100729057) tRNA splicing endonuclease 34 homolog (S. cerevisiae)
Domestic Rabbit(100328906) tRNA splicing endonuclease 34 homolog (S. cerevisiae)
naked mole-rat(101723932) tRNA splicing endonuclease 34 homolog (S. cerevisiae)
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035761 MISSION® esiRNA esiRNA human TSEN34 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077446 Rosetta Predictions human pricing
NM_024075 Rosetta Predictions human pricing
NM_001006968 Rosetta Predictions rat pricing
NM_024168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312594 predicted 821
2 SASI_Hs02_00312595 predicted 828
3 SASI_Hs02_00312596 predicted 988
4 SASI_Hs02_00312597 predicted 431
5 SASI_Hs02_00312598 predicted 642
6 SASI_Hs02_00312599 predicted 1101
7 SASI_Hs02_00312600 predicted 486
8 SASI_Hs02_00312601 predicted 866
9 SASI_Hs02_00312602 predicted 1132
10 SASI_Hs02_00312603 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356540 predicted 811
2 SASI_Hs02_00356541 predicted 824
3 SASI_Hs01_00024270 predicted 986
4 SASI_Hs02_00356542 predicted 427
5 SASI_Hs01_00024273 predicted 639
6 SASI_Hs02_00356543 predicted 1097
7 SASI_Hs01_00024275 predicted 482
8 SASI_Hs01_00024276 predicted 862
9 SASI_Hs02_00356544 predicted 1131
10 SASI_Hs01_00024277 predicted 999
11 SASI_Hs01_00024271 predicted 774
12 SASI_Hs01_00024272 predicted 438
13 SASI_Hs01_00024274 predicted 551
14 SASI_Hs01_00024278 predicted 478
15 SASI_Hs01_00024279 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085265 predicted 270
2 SASI_Rn01_00085266 predicted 835
3 SASI_Rn01_00085268 predicted 850
4 SASI_Rn01_00085269 predicted 534
5 SASI_Rn01_00085270 predicted 797
6 SASI_Rn01_00085271 predicted 341
7 SASI_Rn01_00085273 predicted 685
8 SASI_Rn01_00085274 predicted 739
9 SASI_Rn02_00198522 predicted 271
10 SASI_Rn02_00198523 predicted 625
11 SASI_Rn01_00085267 predicted 783
12 SASI_Rn01_00085272 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070888 predicted 304
2 SASI_Mm01_00070889 predicted 574
3 SASI_Mm01_00070890 predicted 786
4 SASI_Mm01_00070891 predicted 450
5 SASI_Mm01_00070892 predicted 737
6 SASI_Mm01_00070893 predicted 645
7 SASI_Mm01_00070894 predicted 372
8 SASI_Mm01_00070895 predicted 707
9 SASI_Mm01_00070897 predicted 474
10 SASI_Mm02_00327471 predicted 585
11 SASI_Mm01_00070896 predicted 806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024075
TSEN34 MISSION shRNA Bacterial Glycerol Stock
TSEN34 tRNA splicing endonuclease subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-608s21c1
Sequence:CCGGTCCCAAGCAGGACCCTCAAATCTCGAGATTTGAGGGTCCTGCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-439s21c1
Sequence:CCGGGGAGCTCCTGGAGAAGATTACCTCGAGGTAATCTTCTCCAGGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-766s21c1
Sequence:CCGGGCGCTACAGTATCTACAGAGACTCGAGTCTCTGTAGATACTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024075.2-1134s21c1
Sequence:CCGGTACCTTTCTCCGCGGTTAGTTCTCGAGAACTAACCGCGGAGAAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-831s21c1
Sequence:CCGGGAGGTGACTTCCTGGTCTATCCTCGAGGATAGACCAGGAAGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-473s1c1
Sequence:CCGGGCTGCTAAGAAGCAGAAACTACTCGAGTAGTTTCTGCTTCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-993s1c1
Sequence:CCGGGCCTGATGGTAAGGTGGTCTACTCGAGTAGACCACCTTACCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-769s1c1
Sequence:CCGGGCGCTACAGTATCTACAGAGACTCGAGTCTCTGTAGATACTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-1080s1c1
Sequence:CCGGGCAAGAGCCTTTCTGGATGTTCTCGAGAACATCCAGAAAGGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-879s1c1
Sequence:CCGGCCCATTATATCGCTCAGTGCTCTCGAGAGCACTGAGCGATATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024075
TSEN34 MISSION shRNA shRNA Plasmid DNA
TSEN34 tRNA splicing endonuclease subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-608s21c1
Sequence:CCGGTCCCAAGCAGGACCCTCAAATCTCGAGATTTGAGGGTCCTGCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-439s21c1
Sequence:CCGGGGAGCTCCTGGAGAAGATTACCTCGAGGTAATCTTCTCCAGGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-766s21c1
Sequence:CCGGGCGCTACAGTATCTACAGAGACTCGAGTCTCTGTAGATACTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024075.2-1134s21c1
Sequence:CCGGTACCTTTCTCCGCGGTTAGTTCTCGAGAACTAACCGCGGAGAAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-831s21c1
Sequence:CCGGGAGGTGACTTCCTGGTCTATCCTCGAGGATAGACCAGGAAGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-473s1c1
Sequence:CCGGGCTGCTAAGAAGCAGAAACTACTCGAGTAGTTTCTGCTTCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-993s1c1
Sequence:CCGGGCCTGATGGTAAGGTGGTCTACTCGAGTAGACCACCTTACCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-769s1c1
Sequence:CCGGGCGCTACAGTATCTACAGAGACTCGAGTCTCTGTAGATACTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-1080s1c1
Sequence:CCGGGCAAGAGCCTTTCTGGATGTTCTCGAGAACATCCAGAAAGGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-879s1c1
Sequence:CCGGCCCATTATATCGCTCAGTGCTCTCGAGAGCACTGAGCGATATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024075
TSEN34 MISSION shRNA Lentiviral Transduction Particles
TSEN34 tRNA splicing endonuclease subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-608s21c1
Sequence:CCGGTCCCAAGCAGGACCCTCAAATCTCGAGATTTGAGGGTCCTGCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-439s21c1
Sequence:CCGGGGAGCTCCTGGAGAAGATTACCTCGAGGTAATCTTCTCCAGGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-766s21c1
Sequence:CCGGGCGCTACAGTATCTACAGAGACTCGAGTCTCTGTAGATACTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024075.2-1134s21c1
Sequence:CCGGTACCTTTCTCCGCGGTTAGTTCTCGAGAACTAACCGCGGAGAAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024075.2-831s21c1
Sequence:CCGGGAGGTGACTTCCTGGTCTATCCTCGAGGATAGACCAGGAAGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-473s1c1
Sequence:CCGGGCTGCTAAGAAGCAGAAACTACTCGAGTAGTTTCTGCTTCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-993s1c1
Sequence:CCGGGCCTGATGGTAAGGTGGTCTACTCGAGTAGACCACCTTACCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-769s1c1
Sequence:CCGGGCGCTACAGTATCTACAGAGACTCGAGTCTCTGTAGATACTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-1080s1c1
Sequence:CCGGGCAAGAGCCTTTCTGGATGTTCTCGAGAACATCCAGAAAGGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024075.1-879s1c1
Sequence:CCGGCCCATTATATCGCTCAGTGCTCTCGAGAGCACTGAGCGATATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024168
VALIDATED
TSEN34 MISSION shRNA Bacterial Glycerol Stock
TSEN34 tRNA splicing endonuclease subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024168.1-1154s1c1
Sequence:CCGGGCGATTACTACCTGTGTTGTTCTCGAGAACAACACAGGTAGTAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-814s1c1
Sequence:CCGGGCGTTTCCATGCTCACTACATCTCGAGATGTAGTGAGCATGGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-736s1c1
Sequence:CCGGCCTGTGGGAGAGAGGTTTCTTCTCGAGAAGAAACCTCTCTCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-371s1c1
Sequence:CCGGGAGCTTCTAGAGAAGATCGTACTCGAGTACGATCTTCTCTAGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-290s1c1
Sequence:CCGGGCATCGTTCAAACGCCAGCAACTCGAGTTGCTGGCGTTTGAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024168
VALIDATED
TSEN34 MISSION shRNA shRNA Plasmid DNA
TSEN34 tRNA splicing endonuclease subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024168.1-1154s1c1
Sequence:CCGGGCGATTACTACCTGTGTTGTTCTCGAGAACAACACAGGTAGTAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-814s1c1
Sequence:CCGGGCGTTTCCATGCTCACTACATCTCGAGATGTAGTGAGCATGGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-736s1c1
Sequence:CCGGCCTGTGGGAGAGAGGTTTCTTCTCGAGAAGAAACCTCTCTCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-371s1c1
Sequence:CCGGGAGCTTCTAGAGAAGATCGTACTCGAGTACGATCTTCTCTAGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-290s1c1
Sequence:CCGGGCATCGTTCAAACGCCAGCAACTCGAGTTGCTGGCGTTTGAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024168
VALIDATED
TSEN34 MISSION shRNA Lentiviral Transduction Particles
TSEN34 tRNA splicing endonuclease subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024168.1-1154s1c1
Sequence:CCGGGCGATTACTACCTGTGTTGTTCTCGAGAACAACACAGGTAGTAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-814s1c1
Sequence:CCGGGCGTTTCCATGCTCACTACATCTCGAGATGTAGTGAGCATGGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-736s1c1
Sequence:CCGGCCTGTGGGAGAGAGGTTTCTTCTCGAGAAGAAACCTCTCTCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-371s1c1
Sequence:CCGGGAGCTTCTAGAGAAGATCGTACTCGAGTACGATCTTCTCTAGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024168.1-290s1c1
Sequence:CCGGGCATCGTTCAAACGCCAGCAACTCGAGTTGCTGGCGTTTGAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks