EMAIL THIS PAGE TO A FRIEND

TSEN54

TSEN54 tRNA splicing endonuclease subunit

Synonyms: PCH2A PCH4 SEN54L sen54
UniProtKB ID: Q7Z6J9, Q86WV3, Q86XE4, Q8N9H2
Gene ID:
Human(283989) Summary: This gene encodes a subunit of the tRNA splicing endonuclease complex, which catalyzes the removal of introns from precursor tRNAs. The complex is also implicated in pre-mRNA 3-prime end processing. Mutations in this gene result in pontocerebellar hypoplasia type 2.[provided by RefSeq, Oct 2009]
Mouse(76265) tRNA splicing endonuclease 54 homolog (S. cerevisiae)
Rat(690308) tRNA splicing endonuclease 54 homolog (S. cerevisiae)
naked mole-rat(101718062) tRNA splicing endonuclease 54 homolog (S. cerevisiae)
domestic guinea pig(100716767) tRNA splicing endonuclease 54 homolog (S. cerevisiae)
cow(511091) tRNA splicing endonuclease 54 homolog (S. cerevisiae)
sheep(101120680) tRNA splicing endonuclease 54 homolog (S. cerevisiae)
Zebrafish(553550) tRNA splicing endonuclease 54 homolog (S. cerevisiae)
chicken(422126) tRNA splicing endonuclease 54 homolog (S. cerevisiae)
domestic cat(101094714) tRNA splicing endonuclease 54 homolog (S. cerevisiae)
dog(483315) tRNA splicing endonuclease 54 homolog (S. cerevisiae)
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207346 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207346 Rosetta Predictions human pricing
NM_001109576 Rosetta Predictions rat pricing
NM_029557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135694 predicted 1440
2 SASI_Hs01_00135695 predicted 504
3 SASI_Hs01_00135696 predicted 515
4 SASI_Hs01_00135697 predicted 565
5 SASI_Hs01_00135698 predicted 474
6 SASI_Hs02_00373903 predicted 1434
7 SASI_Hs01_00135699 predicted 521
8 SASI_Hs02_00373904 predicted 744
9 SASI_Hs01_00135701 predicted 1370
10 SASI_Hs01_00135702 predicted 882
11 SASI_Hs01_00135700 predicted 1302
12 SASI_Hs01_00135703 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249751 predicted 847
2 SASI_Rn02_00249752 predicted 1131
3 SASI_Rn02_00249753 predicted 1738
4 SASI_Rn02_00249754 predicted 602
5 SASI_Rn02_00249755 predicted 449
6 SASI_Rn02_00249756 predicted 425
7 SASI_Rn02_00249757 predicted 566
8 SASI_Rn02_00249758 predicted 1463
9 SASI_Rn02_00249759 predicted 938
10 SASI_Rn02_00249760 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065401 predicted 940
2 SASI_Mm01_00065402 predicted 420
3 SASI_Mm01_00065403 predicted 518
4 SASI_Mm01_00065404 predicted 554
5 SASI_Mm01_00065405 predicted 821
6 SASI_Mm01_00065406 predicted 531
7 SASI_Mm01_00065407 predicted 568
8 SASI_Mm01_00065408 predicted 1441
9 SASI_Mm01_00065409 predicted 1431
10 SASI_Mm01_00065410 predicted 1289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207346
VALIDATED
TSEN54 MISSION shRNA Bacterial Glycerol Stock
TSEN54 tRNA splicing endonuclease subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_207346.1-1416s1c1
Sequence:CCGGCGGATGTGCATTAGTGGATTTCTCGAGAAATCCACTAATGCACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207346.1-1386s1c1
Sequence:CCGGCGAAAGAATAACCCTGGCAAACTCGAGTTTGCCAGGGTTATTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_207346.1-1668s1c1
Sequence:CCGGCCAGACTCTAACCTGTAGCTTCTCGAGAAGCTACAGGTTAGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1385s1c1
Sequence:CCGGCCGAAAGAATAACCCTGGCAACTCGAGTTGCCAGGGTTATTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1269s1c1
Sequence:CCGGCATATCTCTGTGCTGCAGACACTCGAGTGTCTGCAGCACAGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1284s1c1
Sequence:CCGGCAGACAACACACCTTCCTGATCTCGAGATCAGGAAGGTGTGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207346.1-1664s1c1
Sequence:CCGGGTACCCAGACTCTAACCTGTACTCGAGTACAGGTTAGAGTCTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1391s1c1
Sequence:CCGGGAATAACCCTGGCAAACCCTACTCGAGTAGGGTTTGCCAGGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_207346.1-589s1c1
Sequence:CCGGGAGATGGCAAGAGAAAGAGGACTCGAGTCCTCTTTCTCTTGCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207346.1-626s1c1
Sequence:CCGGGTCCATTAATAAGAAGGCCAACTCGAGTTGGCCTTCTTATTAATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207346
VALIDATED
TSEN54 MISSION shRNA shRNA Plasmid DNA
TSEN54 tRNA splicing endonuclease subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_207346.1-1416s1c1
Sequence:CCGGCGGATGTGCATTAGTGGATTTCTCGAGAAATCCACTAATGCACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207346.1-1386s1c1
Sequence:CCGGCGAAAGAATAACCCTGGCAAACTCGAGTTTGCCAGGGTTATTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_207346.1-1668s1c1
Sequence:CCGGCCAGACTCTAACCTGTAGCTTCTCGAGAAGCTACAGGTTAGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1385s1c1
Sequence:CCGGCCGAAAGAATAACCCTGGCAACTCGAGTTGCCAGGGTTATTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1269s1c1
Sequence:CCGGCATATCTCTGTGCTGCAGACACTCGAGTGTCTGCAGCACAGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1284s1c1
Sequence:CCGGCAGACAACACACCTTCCTGATCTCGAGATCAGGAAGGTGTGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207346.1-1664s1c1
Sequence:CCGGGTACCCAGACTCTAACCTGTACTCGAGTACAGGTTAGAGTCTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1391s1c1
Sequence:CCGGGAATAACCCTGGCAAACCCTACTCGAGTAGGGTTTGCCAGGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_207346.1-589s1c1
Sequence:CCGGGAGATGGCAAGAGAAAGAGGACTCGAGTCCTCTTTCTCTTGCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207346.1-626s1c1
Sequence:CCGGGTCCATTAATAAGAAGGCCAACTCGAGTTGGCCTTCTTATTAATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207346
VALIDATED
TSEN54 MISSION shRNA Lentiviral Transduction Particles
TSEN54 tRNA splicing endonuclease subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_207346.1-1416s1c1
Sequence:CCGGCGGATGTGCATTAGTGGATTTCTCGAGAAATCCACTAATGCACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207346.1-1386s1c1
Sequence:CCGGCGAAAGAATAACCCTGGCAAACTCGAGTTTGCCAGGGTTATTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_207346.1-1668s1c1
Sequence:CCGGCCAGACTCTAACCTGTAGCTTCTCGAGAAGCTACAGGTTAGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1385s1c1
Sequence:CCGGCCGAAAGAATAACCCTGGCAACTCGAGTTGCCAGGGTTATTCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1269s1c1
Sequence:CCGGCATATCTCTGTGCTGCAGACACTCGAGTGTCTGCAGCACAGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1284s1c1
Sequence:CCGGCAGACAACACACCTTCCTGATCTCGAGATCAGGAAGGTGTGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207346.1-1664s1c1
Sequence:CCGGGTACCCAGACTCTAACCTGTACTCGAGTACAGGTTAGAGTCTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207346.1-1391s1c1
Sequence:CCGGGAATAACCCTGGCAAACCCTACTCGAGTAGGGTTTGCCAGGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_207346.1-589s1c1
Sequence:CCGGGAGATGGCAAGAGAAAGAGGACTCGAGTCCTCTTTCTCTTGCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207346.1-626s1c1
Sequence:CCGGGTCCATTAATAAGAAGGCCAACTCGAGTTGGCCTTCTTATTAATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029557
VALIDATED
TSEN54 MISSION shRNA Bacterial Glycerol Stock
TSEN54 tRNA splicing endonuclease subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-1360s21c1
Sequence:CCGGGCAGATCAGCTTCGATGTTTACTCGAGTAAACATCGAAGCTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-1657s21c1
Sequence:CCGGCGTGCCAGCTGTCTCTCATATCTCGAGATATGAGAGACAGCTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029557.1-1586s21c1
Sequence:CCGGAGGGATCTGGGCCACTGAATACTCGAGTATTCAGTGGCCCAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-561s21c1
Sequence:CCGGCTTACGAGCGGCAGCTTAATTCTCGAGAATTAAGCTGCCGCTCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-634s21c1
Sequence:CCGGTTCCAGCTGTCGGTCTGTTAACTCGAGTTAACAGACCGACAGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029557
VALIDATED
TSEN54 MISSION shRNA shRNA Plasmid DNA
TSEN54 tRNA splicing endonuclease subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-1360s21c1
Sequence:CCGGGCAGATCAGCTTCGATGTTTACTCGAGTAAACATCGAAGCTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-1657s21c1
Sequence:CCGGCGTGCCAGCTGTCTCTCATATCTCGAGATATGAGAGACAGCTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029557.1-1586s21c1
Sequence:CCGGAGGGATCTGGGCCACTGAATACTCGAGTATTCAGTGGCCCAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-561s21c1
Sequence:CCGGCTTACGAGCGGCAGCTTAATTCTCGAGAATTAAGCTGCCGCTCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-634s21c1
Sequence:CCGGTTCCAGCTGTCGGTCTGTTAACTCGAGTTAACAGACCGACAGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029557
VALIDATED
TSEN54 MISSION shRNA Lentiviral Transduction Particles
TSEN54 tRNA splicing endonuclease subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-1360s21c1
Sequence:CCGGGCAGATCAGCTTCGATGTTTACTCGAGTAAACATCGAAGCTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-1657s21c1
Sequence:CCGGCGTGCCAGCTGTCTCTCATATCTCGAGATATGAGAGACAGCTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029557.1-1586s21c1
Sequence:CCGGAGGGATCTGGGCCACTGAATACTCGAGTATTCAGTGGCCCAGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-561s21c1
Sequence:CCGGCTTACGAGCGGCAGCTTAATTCTCGAGAATTAAGCTGCCGCTCGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029557.1-634s21c1
Sequence:CCGGTTCCAGCTGTCGGTCTGTTAACTCGAGTTAACAGACCGACAGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks