EMAIL THIS PAGE TO A FRIEND

TSFM

Ts translation elongation factor, mitochondrial

Synonyms: EFTS EFTSMT
UniProtKB ID: P43897, B4E391, F5H2T7, Q561V7, Q8TBC2, Q9UQK0
Gene ID:
Human(10102) Summary: This gene encodes a mitochondrial translation elongation factor. The encoded protein is an enzyme that catalyzes the exchange of guanine nucleotides on the translation elongation factor Tu during the elongation step of mitchondrial protein translation. Mutations in this gene are associated with combined oxidative phosphorylation deficiency-3 syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Mouse(66399) Ts translation elongation factor, mitochondrial
Rat(679068) Ts translation elongation factor, mitochondrial
Zebrafish(567785) Ts translation elongation factor, mitochondrial
domestic cat(101098878) Ts translation elongation factor, mitochondrial
dog(481134) Ts translation elongation factor, mitochondrial
cow(281551) Ts translation elongation factor, mitochondrial
sheep(101115108) Ts translation elongation factor, mitochondrial
domestic guinea pig(100716849) Ts translation elongation factor, mitochondrial
naked mole-rat(101700241) Ts translation elongation factor, mitochondrial
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005726 Rosetta Predictions human pricing
XM_001054607 Rosetta Predictions rat pricing
XM_001054665 Rosetta Predictions rat pricing
NM_025537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340148 predicted 469
2 SASI_Hs02_00340149 predicted 381
3 SASI_Hs02_00340150 predicted 675
4 SASI_Hs02_00340151 predicted 392
5 SASI_Hs02_00340152 predicted 471
6 SASI_Hs02_00340153 predicted 678
7 SASI_Hs01_00225216 predicted 274
8 SASI_Hs02_00340154 predicted 383
9 SASI_Hs02_00340155 predicted 479
10 SASI_Hs02_00340156 predicted 1505
11 SASI_Hs01_00225214 predicted 796
12 SASI_Hs01_00225215 predicted 798
13 SASI_Hs01_00225217 predicted 937
14 SASI_Hs01_00225218 predicted 812
15 SASI_Hs01_00225219 predicted 954
16 SASI_Hs01_00225220 predicted 850
17 SASI_Hs01_00225221 predicted 802
18 SASI_Hs01_00225222 predicted 853
19 SASI_Hs01_00225223 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276450 predicted 744
2 SASI_Rn02_00276451 predicted 469
3 SASI_Rn02_00276452 predicted 484
4 SASI_Rn02_00276453 predicted 658
5 SASI_Rn02_00276454 predicted 545
6 SASI_Rn02_00276455 predicted 502
7 SASI_Rn02_00276456 predicted 446
8 SASI_Rn02_00276457 predicted 669
9 SASI_Rn02_00276458 predicted 450
10 SASI_Rn02_00276459 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276717 predicted 479
2 SASI_Rn02_00276718 predicted 738
3 SASI_Rn02_00276719 predicted 461
4 SASI_Rn02_00276720 predicted 556
5 SASI_Rn02_00276721 predicted 650
6 SASI_Rn02_00276722 predicted 449
7 SASI_Rn02_00276723 predicted 663
8 SASI_Rn02_00276724 predicted 451
9 SASI_Rn02_00276725 predicted 394
10 SASI_Rn02_00276726 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328460 predicted 338
2 SASI_Mm02_00328461 predicted 371
3 SASI_Mm01_00120014 predicted 653
4 SASI_Mm01_00120015 predicted 633
5 SASI_Mm01_00120016 predicted 484
6 SASI_Mm01_00120017 predicted 440
7 SASI_Mm01_00120019 predicted 585
8 SASI_Mm01_00120020 predicted 556
9 SASI_Mm01_00120021 predicted 441
10 SASI_Mm01_00120022 predicted 579
11 SASI_Mm01_00120013 predicted 248
12 SASI_Mm01_00120018 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005726
VALIDATED
TSFM MISSION shRNA Bacterial Glycerol Stock
Ts translation elongation factor, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-474s21c1
Sequence:CCGGCCCTTGGAACCATGATGCATTCTCGAGAATGCATCATGGTTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-593s21c1
Sequence:CCGGCTCAAGGATCAGTTGGCTTTACTCGAGTAAAGCCAACTGATCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-226s21c1
Sequence:CCGGCTCCTTTGTAAATTGCAAGAACTCGAGTTCTTGCAATTTACAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005726.4-380s21c1
Sequence:CCGGCAGGAAGGAAACACAACTGTACTCGAGTACAGTTGTGTTTCCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-971s21c1
Sequence:CCGGGTAGACTTTGTGCGGTTTGAACTCGAGTTCAAACCGCACAAAGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-1015s1c1
Sequence:CCGGGTAGACTTTGTGCGGTTTGAACTCGAGTTCAAACCGCACAAAGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-361s1c1
Sequence:CCGGCAGGAAGGAAACACAACTGTACTCGAGTACAGTTGTGTTTCCTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-455s1c1
Sequence:CCGGCCCTTGGAACCATGATGCATTCTCGAGAATGCATCATGGTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-207s1c1
Sequence:CCGGCTCCTTTGTAAATTGCAAGAACTCGAGTTCTTGCAATTTACAAAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-637s1c1
Sequence:CCGGCTCAAGGATCAGTTGGCTTTACTCGAGTAAAGCCAACTGATCCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005726
VALIDATED
TSFM MISSION shRNA shRNA Plasmid DNA
Ts translation elongation factor, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-474s21c1
Sequence:CCGGCCCTTGGAACCATGATGCATTCTCGAGAATGCATCATGGTTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-593s21c1
Sequence:CCGGCTCAAGGATCAGTTGGCTTTACTCGAGTAAAGCCAACTGATCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-226s21c1
Sequence:CCGGCTCCTTTGTAAATTGCAAGAACTCGAGTTCTTGCAATTTACAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005726.4-380s21c1
Sequence:CCGGCAGGAAGGAAACACAACTGTACTCGAGTACAGTTGTGTTTCCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-971s21c1
Sequence:CCGGGTAGACTTTGTGCGGTTTGAACTCGAGTTCAAACCGCACAAAGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-1015s1c1
Sequence:CCGGGTAGACTTTGTGCGGTTTGAACTCGAGTTCAAACCGCACAAAGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-361s1c1
Sequence:CCGGCAGGAAGGAAACACAACTGTACTCGAGTACAGTTGTGTTTCCTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-455s1c1
Sequence:CCGGCCCTTGGAACCATGATGCATTCTCGAGAATGCATCATGGTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-207s1c1
Sequence:CCGGCTCCTTTGTAAATTGCAAGAACTCGAGTTCTTGCAATTTACAAAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-637s1c1
Sequence:CCGGCTCAAGGATCAGTTGGCTTTACTCGAGTAAAGCCAACTGATCCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005726
VALIDATED
TSFM MISSION shRNA Lentiviral Transduction Particles
Ts translation elongation factor, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-474s21c1
Sequence:CCGGCCCTTGGAACCATGATGCATTCTCGAGAATGCATCATGGTTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-593s21c1
Sequence:CCGGCTCAAGGATCAGTTGGCTTTACTCGAGTAAAGCCAACTGATCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-226s21c1
Sequence:CCGGCTCCTTTGTAAATTGCAAGAACTCGAGTTCTTGCAATTTACAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005726.4-380s21c1
Sequence:CCGGCAGGAAGGAAACACAACTGTACTCGAGTACAGTTGTGTTTCCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005726.4-971s21c1
Sequence:CCGGGTAGACTTTGTGCGGTTTGAACTCGAGTTCAAACCGCACAAAGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-1015s1c1
Sequence:CCGGGTAGACTTTGTGCGGTTTGAACTCGAGTTCAAACCGCACAAAGTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-361s1c1
Sequence:CCGGCAGGAAGGAAACACAACTGTACTCGAGTACAGTTGTGTTTCCTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-455s1c1
Sequence:CCGGCCCTTGGAACCATGATGCATTCTCGAGAATGCATCATGGTTCCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-207s1c1
Sequence:CCGGCTCCTTTGTAAATTGCAAGAACTCGAGTTCTTGCAATTTACAAAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005726.2-637s1c1
Sequence:CCGGCTCAAGGATCAGTTGGCTTTACTCGAGTAAAGCCAACTGATCCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025537
VALIDATED
TSFM MISSION shRNA Bacterial Glycerol Stock
Ts translation elongation factor, mitochondrial
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-191s1c1
Sequence:CCGGCTCCTTTGTCAACTGCAAGAACTCGAGTTCTTGCAGTTGACAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-311s1c1
Sequence:CCGGGAGGAAGACTAAAGAAGGCTTCTCGAGAAGCCTTCTTTAGTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-372s1c1
Sequence:CCGGGAGGTAAACTGTGAGACAGATCTCGAGATCTGTCTCACAGTTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-879s1c1
Sequence:CCGGCTCCTGGATCCTTCCATTACACTCGAGTGTAATGGAAGGATCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025537
VALIDATED
TSFM MISSION shRNA shRNA Plasmid DNA
Ts translation elongation factor, mitochondrial
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-191s1c1
Sequence:CCGGCTCCTTTGTCAACTGCAAGAACTCGAGTTCTTGCAGTTGACAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-311s1c1
Sequence:CCGGGAGGAAGACTAAAGAAGGCTTCTCGAGAAGCCTTCTTTAGTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-372s1c1
Sequence:CCGGGAGGTAAACTGTGAGACAGATCTCGAGATCTGTCTCACAGTTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-879s1c1
Sequence:CCGGCTCCTGGATCCTTCCATTACACTCGAGTGTAATGGAAGGATCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025537
VALIDATED
TSFM MISSION shRNA Lentiviral Transduction Particles
Ts translation elongation factor, mitochondrial
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-191s1c1
Sequence:CCGGCTCCTTTGTCAACTGCAAGAACTCGAGTTCTTGCAGTTGACAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-311s1c1
Sequence:CCGGGAGGAAGACTAAAGAAGGCTTCTCGAGAAGCCTTCTTTAGTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-372s1c1
Sequence:CCGGGAGGTAAACTGTGAGACAGATCTCGAGATCTGTCTCACAGTTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025537.2-879s1c1
Sequence:CCGGCTCCTGGATCCTTCCATTACACTCGAGTGTAATGGAAGGATCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks