EMAIL THIS PAGE TO A FRIEND

TSG101

tumor susceptibility 101

Synonyms: TSG10 VPS23
UniProtKB ID: Q99816, Q9BUM5
Gene ID:
Human(7251) Summary: The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]
Mouse(22088) tumor susceptibility gene 101
Rat(292925) tumor susceptibility gene 101
fruit fly(39881) tumor suppressor protein 101
chicken(423082) tumor susceptibility gene 101
dog(485406) tumor susceptibility gene 101
Horse(100057099) tumor susceptibility gene 101
domestic cat(101100915) tumor susceptibility gene 101
Zebrafish(415179) tumor susceptibility gene 101
naked mole-rat(101716856) tumor susceptibility gene 101
Domestic Rabbit(100343429) tumor susceptibility gene 101
domestic guinea pig(100713139) tumor susceptibility gene 101
cow(507659) tumor susceptibility gene 101
sheep(101118061) tumor susceptibility gene 101
Goat(100861362) tumor susceptibility gene 101
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38773 Anti-TSG101 (AB1) antibody produced in rabbit IgG fraction of antiserum bovine, mouse, rat, horse, rabbit, zebrafish, canine, guinea pig, human
western blot pricing
AV37310 Anti-TSG101 (AB2) antibody produced in rabbit IgG fraction of antiserum canine, human, horse, bovine, guinea pig, rat, rabbit, mouse
western blot pricing
AV37911 Anti-TSG101 (AB3) antibody produced in rabbit IgG fraction of antiserum horse, human, mouse, canine, guinea pig, rabbit, bovine, rat
western blot pricing
T5951 Anti-TSG101 (C-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
T5826 Anti-TSG101 (N-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
microarray, western blot pricing
SAB1406556 Anti-TSG101 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
T5701 Anti-TSG101 antibody produced in rabbit ~2 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
HPA006161 Anti-TSG101 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
WH0007251M1 Monoclonal Anti-TSG101 antibody produced in mouse clone 5B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2702167 Monoclonal Anti-TSG101 antibody produced in mouse mouse, human, rat, monkey
immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
PLA0283 Rabbit anti-TSG101 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. chicken, turkey, horse, rabbit, mouse, rat, goat, dog, bovine, guinea pig, human, pig
proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006292 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006292 Rosetta Predictions human pricing
NM_181628 Rosetta Predictions rat pricing
NM_021884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180607 predicted 874
2 SASI_Hs01_00180608 predicted 1134
3 SASI_Hs02_00341284 predicted 303
4 SASI_Hs01_00180610 predicted 275
5 SASI_Hs01_00180611 predicted 956
6 SASI_Hs01_00180613 predicted 313
7 SASI_Hs02_00341285 predicted 1301
8 SASI_Hs01_00180615 predicted 467
9 SASI_Hs01_00180616 predicted 937
10 SASI_Hs02_00341286 predicted 192
11 SASI_Hs01_00180609 predicted 402
12 SASI_Hs01_00180612 predicted 445
13 SASI_Hs01_00180614 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084805 predicted 226
2 SASI_Rn01_00084806 predicted 420
3 SASI_Rn01_00084807 predicted 331
4 SASI_Rn01_00084808 predicted 978
5 SASI_Rn01_00084809 predicted 309
6 SASI_Rn01_00084810 predicted 546
7 SASI_Rn01_00084811 predicted 1021
8 SASI_Rn01_00084812 predicted 416
9 SASI_Rn01_00084814 predicted 799
10 SASI_Rn02_00269764 predicted 1201
11 SASI_Rn01_00084813 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065312 predicted 232
2 SASI_Mm01_00065313 predicted 826
3 SASI_Mm01_00065314 predicted 1033
4 SASI_Mm02_00326445 predicted 1316
5 SASI_Mm01_00065315 predicted 394
6 SASI_Mm01_00065316 predicted 720
7 SASI_Mm01_00065317 predicted 573
8 SASI_Mm02_00326446 predicted 1311
9 SASI_Mm01_00065318 predicted 339
10 SASI_Mm01_00065319 predicted 906
11 SASI_Mm01_00065311 predicted 228
12 SASI_Mm01_00065320 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006292
VALIDATED
TSG101 MISSION shRNA Bacterial Glycerol Stock
tumor susceptibility 101
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006292.2-460s1c1
Sequence:CCGGCCTTATCTACATGAATGGAAACTCGAGTTTCCATTCATGTAGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006292.2-309s1c1
Sequence:CCGGGCCTTATAGAGGTAATACATACTCGAGTATGTATTACCTCTATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006292.2-877s1c1
Sequence:CCGGGCAGAGCTCAATGCCTTGAAACTCGAGTTTCAAGGCATTGAGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006292.2-1368s1c1
Sequence:CCGGCCCAGAATAAGTTATTGCAGTCTCGAGACTGCAATAACTTATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006292.2-556s1c1
Sequence:CCGGCGTCCTATTTCGGCATCCTATCTCGAGATAGGATGCCGAAATAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-180s21c1
Sequence:GTACCGGAGACCTAACTGTACGTGAAACCTCGAGGTTTCACGTACAGTTAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-545s21c1
Sequence:GTACCGGCAGTCTTCTCTCGTCCTATTTCTCGAGAAATAGGACGAGAGAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-877s21c1
Sequence:CCGGGCAGAGCTCAATGCCTTGAAACTCGAGTTTCAAGGCATTGAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-354s21c1
Sequence:CCGGACTGGACACATACCCATATAACTCGAGTTATATGGGTATGTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-1213s21c1
Sequence:CCGGGTACGTCTTCTGTCCCGTAAACTCGAGTTTACGGGACAGAAGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-309s21c1
Sequence:CCGGGCCTTATAGAGGTAATACATACTCGAGTATGTATTACCTCTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-1316s21c1
Sequence:GTACCGGTGGAGGTTGAGCTCTTCTTAACTCGAGTTAAGAAGAGCTCAACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-963s21c1
Sequence:GTACCGGAGAAGTAGCCGAGGTTGATAACTCGAGTTATCAACCTCGGCTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006292
VALIDATED
TSG101 MISSION shRNA shRNA Plasmid DNA
tumor susceptibility 101
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006292.2-460s1c1
Sequence:CCGGCCTTATCTACATGAATGGAAACTCGAGTTTCCATTCATGTAGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006292.2-309s1c1
Sequence:CCGGGCCTTATAGAGGTAATACATACTCGAGTATGTATTACCTCTATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006292.2-877s1c1
Sequence:CCGGGCAGAGCTCAATGCCTTGAAACTCGAGTTTCAAGGCATTGAGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006292.2-1368s1c1
Sequence:CCGGCCCAGAATAAGTTATTGCAGTCTCGAGACTGCAATAACTTATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006292.2-556s1c1
Sequence:CCGGCGTCCTATTTCGGCATCCTATCTCGAGATAGGATGCCGAAATAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-180s21c1
Sequence:GTACCGGAGACCTAACTGTACGTGAAACCTCGAGGTTTCACGTACAGTTAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-545s21c1
Sequence:GTACCGGCAGTCTTCTCTCGTCCTATTTCTCGAGAAATAGGACGAGAGAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-877s21c1
Sequence:CCGGGCAGAGCTCAATGCCTTGAAACTCGAGTTTCAAGGCATTGAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-354s21c1
Sequence:CCGGACTGGACACATACCCATATAACTCGAGTTATATGGGTATGTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-1213s21c1
Sequence:CCGGGTACGTCTTCTGTCCCGTAAACTCGAGTTTACGGGACAGAAGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-309s21c1
Sequence:CCGGGCCTTATAGAGGTAATACATACTCGAGTATGTATTACCTCTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-1316s21c1
Sequence:GTACCGGTGGAGGTTGAGCTCTTCTTAACTCGAGTTAAGAAGAGCTCAACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-963s21c1
Sequence:GTACCGGAGAAGTAGCCGAGGTTGATAACTCGAGTTATCAACCTCGGCTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006292
VALIDATED
TSG101 MISSION shRNA Lentiviral Transduction Particles
tumor susceptibility 101
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006292.2-460s1c1
Sequence:CCGGCCTTATCTACATGAATGGAAACTCGAGTTTCCATTCATGTAGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006292.2-309s1c1
Sequence:CCGGGCCTTATAGAGGTAATACATACTCGAGTATGTATTACCTCTATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006292.2-877s1c1
Sequence:CCGGGCAGAGCTCAATGCCTTGAAACTCGAGTTTCAAGGCATTGAGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006292.2-1368s1c1
Sequence:CCGGCCCAGAATAAGTTATTGCAGTCTCGAGACTGCAATAACTTATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006292.2-556s1c1
Sequence:CCGGCGTCCTATTTCGGCATCCTATCTCGAGATAGGATGCCGAAATAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-180s21c1
Sequence:GTACCGGAGACCTAACTGTACGTGAAACCTCGAGGTTTCACGTACAGTTAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-545s21c1
Sequence:GTACCGGCAGTCTTCTCTCGTCCTATTTCTCGAGAAATAGGACGAGAGAAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-877s21c1
Sequence:CCGGGCAGAGCTCAATGCCTTGAAACTCGAGTTTCAAGGCATTGAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-354s21c1
Sequence:CCGGACTGGACACATACCCATATAACTCGAGTTATATGGGTATGTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-1213s21c1
Sequence:CCGGGTACGTCTTCTGTCCCGTAAACTCGAGTTTACGGGACAGAAGACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-309s21c1
Sequence:CCGGGCCTTATAGAGGTAATACATACTCGAGTATGTATTACCTCTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-1316s21c1
Sequence:GTACCGGTGGAGGTTGAGCTCTTCTTAACTCGAGTTAAGAAGAGCTCAACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006292.2-963s21c1
Sequence:GTACCGGAGAAGTAGCCGAGGTTGATAACTCGAGTTATCAACCTCGGCTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021884
VALIDATED
TSG101 MISSION shRNA Bacterial Glycerol Stock
tumor susceptibility 101
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021884.1-1135s1c1
Sequence:CCGGCCCGTAAACAGTTCCAGCTAACTCGAGTTAGCTGGAACTGTTTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021884.1-1044s1c1
Sequence:CCGGGCTATTGAAGACACTATCTTTCTCGAGAAAGATAGTGTCTTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021884.1-536s1c1
Sequence:CCGGGCCAAGTGGAATCTCTGCATACTCGAGTATGCAGAGATTCCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021884.1-95s1c1
Sequence:CCGGCGTCCGTCAAACTGTCAATGTCTCGAGACATTGACAGTTTGACGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021884.1-464s1c1
Sequence:CCGGGCCTACTGTTTCTGCATCCTACTCGAGTAGGATGCAGAAACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021884
VALIDATED
TSG101 MISSION shRNA shRNA Plasmid DNA
tumor susceptibility 101
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021884.1-1135s1c1
Sequence:CCGGCCCGTAAACAGTTCCAGCTAACTCGAGTTAGCTGGAACTGTTTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021884.1-1044s1c1
Sequence:CCGGGCTATTGAAGACACTATCTTTCTCGAGAAAGATAGTGTCTTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021884.1-536s1c1
Sequence:CCGGGCCAAGTGGAATCTCTGCATACTCGAGTATGCAGAGATTCCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021884.1-95s1c1
Sequence:CCGGCGTCCGTCAAACTGTCAATGTCTCGAGACATTGACAGTTTGACGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021884.1-464s1c1
Sequence:CCGGGCCTACTGTTTCTGCATCCTACTCGAGTAGGATGCAGAAACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021884
VALIDATED
TSG101 MISSION shRNA Lentiviral Transduction Particles
tumor susceptibility 101
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021884.1-1135s1c1
Sequence:CCGGCCCGTAAACAGTTCCAGCTAACTCGAGTTAGCTGGAACTGTTTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021884.1-1044s1c1
Sequence:CCGGGCTATTGAAGACACTATCTTTCTCGAGAAAGATAGTGTCTTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021884.1-536s1c1
Sequence:CCGGGCCAAGTGGAATCTCTGCATACTCGAGTATGCAGAGATTCCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021884.1-95s1c1
Sequence:CCGGCGTCCGTCAAACTGTCAATGTCTCGAGACATTGACAGTTTGACGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021884.1-464s1c1
Sequence:CCGGGCCTACTGTTTCTGCATCCTACTCGAGTAGGATGCAGAAACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks